Information

Can rats pass on memories of a maze to their offspring?

Can rats pass on memories of a maze to their offspring?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

A friend of mine told me once about a documentary movie he saw some years ago. On this movie he saw scientists talking about particular experiment. This experiment involved rats and probably electrical traps. The rat had to get to the cheese, there were traps on the shortest route to it, and obviously it got shocked few times. What is interesting is that my friend says that when they took its offspring (probably born later) they avoided those traps.

I'm aware that its not how "genetic memory" works. Its not memory of individual, but of species (so it requires evolution). This is what I'm trying to explain to him, but he says "he knows what he saw".

Anyway maybe someone here is aware of such an experiment. I believe that he is wrong about something (or conclusions drawn where changed later), so I would like to find out more about it.

To sum up:

  • Its not Tryon's Rat Experiment
  • It involved: rats, traps (probably electrical), more then one path to cheese, rat's offspring and some sort of memory/learning amongst rats.

The phenomenon you're talking about was a fad in the 60's, called 'interanimal memory transfer'. It started out when James McConnell performed a later-discredited experiment in which he found that if you chopped up flatworms which had been exposed to some stresses, and fed them to other unexposed flatworms, the unexposed worms became wary of the source of stress quicker after eating their dead companions. He jumped to the conclusion that a 'memory molecule' was being transferred, and that the cannibal worms gained the food worms' memories of the stress.

People then started looking to see if they could:

  1. repeat the experiments
  2. find the same phenomenon in other animals

In the first case, nobody could replicate the experiments in worms, but because McConnell was such a PR genius he managed to convince the public that his results were valid (see Rilling, 1996 for more on this).

In the second case, Frank et al. (1970) and others tried working with rats - I think this is the experiment you're talking about in the question. They found various interesting results including that if you trained rats to run through a maze by using particularly stressful negative reinforcement (like electrocution), then those rats' children would be able to learn the new maze much faster. However, Frank et al. didn't make the same mistake as McConnell - first of all they wondered if the parent rats might be leaving a scent trail. So they used duplicate mazes with the exact same design, putting the children into clean mazes. The children of adults who had already learned the maze continued to outperform the control rats - the explanation was not scent trails.

Next they wondered whether it might be that the second generation rats had been born with a higher wariness as a result of the stress their parents suffered; i.e. it could be a hormonal transfer from mother to child (e.g. cortisol, the stress hormone).

Frank et al. tested their hypothesis by torturing some rats for a while (rules about animal welfare were not strict in the 70's). They would lock some rats in a small jar and bash them about for a long time, then kill them, chop them up, and take out their livers. They fed the livers to other rats, and found that after eating the livers the other rats learned the maze much faster. They interpreted the results in what now seems a sensible light: the stressed rats were producing high concentrations of a stress-signalling molecule. When those rats either had children or were fed to other rats, they passed on high doses of the stress molecule. This raised the alterness and wariness of the receipient rats so that they were much quicker to learn which parts of the maze were dangerous.

There is no evidence that the child rats actually 'remembered' the maze - they still had to find their way around, but they were extremely wary of the electrocution plates and so avoided them, finding the safest way to the end. This is not a case of genetic memory.

  • Frank B, Stein DG, Rosen J. 1970. Interanimal “Memory” Transfer: Results from Brain and Liver Homogenates. Science 169: 399-402.
  • Rilling M. 1996. The mystery of the vanished citations: James McConnell's forgotten 1960s quest for planarian learning, a biochemical engram, and celebrity. American Psychologist 51: 589-598.

This is somewhat unrelated, and for that, I apologize, but I find it truly fascinating, and I believe you will too.

Zebra finches are a song bird that have become a popular model organism for behavioral research. They have a very stereotypical pattern for song learning: at about 70 days after hatching, the baby male song bird starts to listen to his father's song, copy it, practice it, and ultimately learn it. Female birds do not have a courtship song to learn.

Interestingly, if the baby male bird does not learn their father's song, they end up just kind of screeching, and never singing a song. This, in nature, makes them unable to court a female.

But in the lab, this research group did an experiment, where they took these screeching males, let them grow to adulthood, then teach their child as best as they can. The child, wanting to learn a song, takes what it can from the father. After 4 generations of this, the group was able to get de novo song production from these birds.

Unbelievable!

De novo establishment of wild-type song culture in the zebra finch - Fehér et al. - Nature, 2009


https://www.facebook.com/ScienceNaturePage/videos/1319435594855362/

I'm not sure if this is the right link, but there was a video on Facebook called “memories can pass between generations DNA” posted by hashem al-ghaili, it is 4 minutes and refers to an experiment where mice passed on maze knowledge to their offspring…


Parental 'memory' is inherited across generations

Are our personalities and behaviors shaped more by our genes or our circumstances? While this age-old "nature vs. nurture" question continues to confound us and fuel debates, a growing body of evidence from research conducted over recent decades suggests that parental environment can have a profound impact on future generations.

Results of a new Dartmouth study published this week in the journal eLife -- which examined how environmental stressors put on fruit flies (Drosophilia melanogaster) can influence the phenotypes of their offspring -- are adding some intriguing findings to the mix.

"While neuronally encoded behavior isn't thought to be inherited across generations, we wanted to test the possibility that environmentally triggered modifications could allow 'memory' of parental experiences to be inherited," explains Julianna "Lita" Bozler, a PhD candidate in the Bosco Lab at the Geisel School of Medicine, who served as lead author on the study.

When exposed to parasitoid wasps -- which deposit their eggs into and kill the larvae of fruit flies -- Drosophila melanogaster females are known to shift their preference to food containing ethanol as an egg laying substrate, which protects their larvae from wasp infection.

For the study, the fruit flies were cohabitated with female wasps for four days before their eggs were collected. The embryos were separated into two cohorts -- a wasp-exposed and unexposed (control) group -- and developed to maturity without any contact with adult flies or wasps. One group was used to propagate the next generation and the other was analyzed for ethanol preference.

"We found that the original wasp-exposed flies laid about 94 percent of their eggs on ethanol food, and that this behavior persisted in their offspring, even though they'd never had direct interaction with wasps," says Bozler.

The ethanol preference was less potent in the first-generation offspring, with 73 percent of their eggs laid on ethanol food. "But remarkably, this inherited ethanol preference persisted for five generations, gradually reverting back to a pre-wasp exposed level," she says. "This tells us that inheritance of ethanol preference is not a permanent germline change, but rather a reversible trait."

Importantly, the research team determined that one of the critical factors driving ethanol preference behavior is the depression of Neuropeptide-F (NPF) that is imprinted in a specific region of the female fly's brain. While this change, based in part on visual signals, was required to initiate transgenerational inheritance, both male and female progeny were able to pass on ethanol preference to their offspring.

"We're very excited about the findings that Lita, and her lab partner, Balint Kacsoh have made," says Giovanni Bosco, PhD, a professor of molecular and systems biology at Geisel, who directs the Bosco Lab. "They are allowing us to better understand not only the biology and epigenetics of fruit flies, but also some of the foundational mechanisms upon which biologic inheritance is based.

"Of particular interest, are the conserved signaling functions of NPF and its mammalian counterpart NPY in humans," he says. "We hope that our findings may lead to greater insights into the role that parental experiences play across generations in diseases such as drug and alcohol disorders."


Transgenerational Transmission of Trauma?

For any acquired traits to be inherited, the genetic information inside an animal’s reproductive cells—its germ cells—would need to be modified. This modification could theoretically take the form of actual alterations in the DNA code itself, but that does not occur—and that is why Lamarckism was officially abandoned. But epigenetic changes—chemical alterations that work like switches to affect the expression of certain genes—do occur. Some of these are heritable across generations. Two new studies seek to answer whether traumatic memories can be passed on via epigenetic changes from parent to offspring.

Since sperm cells—the male’s contribution to inheritance—are generally produced in large numbers with a fairly rapid turnover, these are the germ cells that would most likely be susceptible to some sort of epigenetic modification in response to a fearful association—if such a thing can occur. Therefore, in both recent studies revisiting Lamarckian inheritance, the impact of the male animal’s fears and memories on offspring was tested.

Male mice at Emory University were conditioned to fear the odor of cherry blossoms. In a dramatic demonstration of heritable epigenetic modification, their sons and grandsons displayed an exaggerated sensitivity to that odor and an enhancement in the neurocircuitry used to detect it. Image from Medical Express.1


Mice Inherit the Fears of Their Fathers

UPDATE (12/1, 2:37pm): This study was just published in Nature Neuroscience you can read all of the juicy details here.

UPDATE (11/17, 11:22 am): I just published a new post showing how scientists reacted to this study on Twitter, with comments ranging from “awe-inspiring biology” to “deep skepticism.”

There’s no question that trauma gets handed down from one generation to the next.

In one highly publicized example, researchers in New York studied several dozen women who were pregnant on September 11, 2001, and had been in the vicinity of the terrorist attacks. Some of these women developed post-traumatic stress disorder (PTSD), and this group shows lower levels of the stress hormone cortisol in their saliva than do those who did not develop PTSD. But here’s the rub: At 9 months old, the babies of the women with PTSD have significantly lower cortisol levels than babies of healthy mothers.

In earlier work, the same researchers had reported low cortisol levels in adult children of Holocaust survivors with PTSD. And in yet another study, Kerry Ressler’s group at Emory University showed that the so-called “startle response” to a sudden stimulus — a marker of anxiety — is more pronounced in kids whose mothers were physically abused as children then in those whose mothers were not abused. I could go on.

But how, exactly, does a parent’s stress leave such a deep impression on its progeny?

Part of it is nurture. A parent’s sadness and stress naturally affects how they interact with other people, including their children. The Holocaust study, in fact, found that the survivors with PTSD tended to emotionally abuse or neglect their children. And we know from some remarkable experiments in rats that parental care affects the offspring’s genes: Rat pups that get a lot of licking and grooming from their mothers show distinct changes in their epigenome, the chemical markers that attach to DNA and can turn genes on and off. Neglected pups, in contrast, don’t show these epigenetic tweaks.

Now a fascinating new study reveals that it’s not just nurture. Traumatic experiences can actually work themselves into the germ line. When a male mouse becomes afraid of a specific smell, this fear is somehow transmitted into his sperm, the study found. His pups will also be afraid of the odor, and will pass that fear down to their pups.

“Parents transfer information to their offspring, and they do so even before the offspring are conceived,” said Brian Dias, a postdoctoral fellow in Ressler’s lab, at an engaging talk about this unpublished data on Tuesday at the Society for Neuroscience meeting in San Diego.

And why, evolutionarily, would a parent pass down such specific information? “So that when the offspring, or descending generations, encounter that environment later in life, they’ll know how to behave appropriately,” Dias said.

The researchers made the mice afraid of certain odors by pairing them with a mild shock to the foot. In a study published a few years ago, Ressler had shown that this type of fear learning is specific: Mice trained to fear one particular smell show an increased startle to that odor but not others. What’s more, this fear learning changes the organization of neurons in the animal’s nose, leading to more cells that are sensitive to that particular smell.

Dias trained mice to fear acetophenone — which, according to this chemist, smells “like orange blossom with a bit of artificial cherry” — over three days, then waited 10 days and allowed the animals to mate. The offspring (known as the F1 generation) show an increased startle to acetophenone (with no shock) even though they have never encountered the smell before. And their reaction is specific: They do not startle to a different odor, propanol (which smells like alcohol). What’s more, the researchers found the same thing in the F1 generation’s offspring (known as F2).

The scientists also looked at the F1 and F2 animals’ brains. When the grandparent generation is trained to fear acetophenone, the F1 and F2 generations have more “M71 neurons” in their noses, Dias said. These cells contain a receptor that detects acetophenone. Their brains also have larger “M71 glomeruli,” a region of the olfactory bulb that responds to this smell. “Like father like son, we’re getting some ancestral information,” Dias said. “But how is that occurring?”

His team performed an in vitro fertilization (IVF) experiment in which they trained animals to fear acetophenone and then 10 days later harvested their sperm. They sent the sperm to another lab across campus where it was used to artificially inseminate female mice. Then the researchers looked at the brains of the offspring. “What is striking is that the neuroanatomical results still persist after IVF,” Dias said. “There’s something in the sperm.”

I’ve been to a lot of scientific talks. The excitement around this one was notable, with many scientists whispering about it in the room and more loudly buzzing in the hallways outside.

But I know what you’re wondering. It was the first question that Dias received from the audience after the talk: “Do you have any idea of how this information being stored in the brain is being transmitted to the gonads?” the questioner asked.

The short answer is that the researchers don’t have any idea, though they’ve thought about several possible explanations. Apparently a study in cats and pigeons showed that after smelling an odor, the odorant receptor molecules can get into the blood stream, and other studies have reported odorant receptors on sperm. So maybe the odor molecules get into the bloodstream and make their way to sperm. Another possibility is that microRNAs — tiny RNA molecules involved in gene expression — get into the bloodstream and deliver odor information to sperm.

For now, though, Dias said, “those are two science-fiction hypotheses.”

Read more about Ressler’s work in a feature on stress and resilience that I wrote for Nature last year.


What’s next?

A good next step in resolving these pesky mechanistic questions would be to use chromatography to see whether odorant molecules like acetophenone actually get into the animals’ bloodstream, Dias says. “The technology is surely there, and I think we are going to go down those routes.”

First, though, Dias and Ressler are working on another behavioral experiment. They want to know: If the F0 mice un-learn the fear of acetophenone (which can be done by repeated exposures to the smell without a shock) and then reproduce, will their children still have an increased sensitivity to it?

“We have no idea yet,” says Ressler, a practicing psychiatrist who has long been interested in the effects of post-traumatic stress disorder (PTSD). “But we think this would have tremendous implications for the treatment of adults [with PTSD] before they have children.”

It will take a lot more work before scientists come close to understanding how these data relate to human anxiety disorders. So what, after all of these words, should we take away from this study now?

Hell if I know. Here’s the most rational and conservative appraisal I can muster: Our bodies are constantly adapting to a changing world. We have many ways of helping our children make that unpredictable world slightly more predictable, and some of those ways seem to be hidden in our genome.

Anne Ferguson-Smith, a geneticist at the University of Cambridge, put it more succinctly. The study, she says, “potentially adds to the growing list of compelling models telling us that something is going on that facilitates transmission of environmentally induced traits.”

Scientists, I have to assume, will be furiously working on what that something is for many decades to come. And I’ll be following along, or trying to, with awe.

*Update, 12/1/13, 2:35pm: It seems that that Pavlov experiment may have been retracted in 1927, though I don’t know anything about that beyond what is stated here.

Style note: A few paragraphs of this post were adapted from my earlier post on this research, published November 15.


If Lab Rats Dream, They Seem to Dream of Mazes

Elephants dream of the grassy Savannah plain. Dogs, paws aquiver, tails thumping faintly in slumber, chase squirrels in the park. And cats, of course, dream of mice.

Or so humans, notoriously prone to anthropomorphic conjecture about the four-legged world, have long suspected.

Yet what animals dream about — or indeed, whether they dream at all — has remained an unanswered question, resistant to scientific scrutiny, if only because animals cannot help out by describing their closed-eye experiences in words.

Now, however, two researchers studying memory have offered compelling evidence that the brains of sleeping animals are at work in a way that is irresistibly suggestive of dreaming. And the animals in question — four pink-eared, black-and white laboratory rats — appeared to be dreaming about something very specific: The maze they were learning to run.

The researchers found that patterns of brain activity identified when the rats ran a circular maze, receiving a reward of chocolate-flavored sprinkles for their efforts, were exactly duplicated when the rats were sleeping.

In particular, the patterns, detected in the firing of clusters of cells in the hippocampus, an area involved with memory formation and storage, were reproduced during phases of sleep that in humans are strongly linked to dreaming. And they were so precise that it was possible for the scientists to tell where in the maze the rat would be if it were awake, and whether it would be moving or standing still.

"The animal is certainly recalling memories of those events as they occurred during the awake state, and it is doing so during dream sleep," said Dr. Matthew Wilson, the senior author of the report and an associate professor of brain and cognitive sciences at the Massachusetts Institute of Technology.

He added that the research is not proof, in the purest sense, that animals dream, but said that since dreaming is fundamentally a subjective experience, the type of evidence gathered in studies of this nature is about as close as scientists are likely to get.

"Call it whatever you want," Dr. Wilson said. "Our ability to ask the animal to report the content of these states is limited."

Although only four rats were studied, Dr. Wilson and other scientists said that the number was sufficient to attain statistical significance, and that the elaborate nature of the controls used in the study made it unlikely that the results were spurious, though more research needs to be done to replicate and extend the findings.

"The likelihood that this would occur by chance is exceedingly small," Dr. Wilson said.

Still, said Dr. Howard Eichenbaum, University Professor of psychology at Boston University, "Many philosophers and scientists puzzle over the problem of whether animals have anything like conscious and cognitive experiences, and this is one more chunk of evidence in favor of the view that they have experiences like some of ours."

Other scientists said the new research is important not only for the window it offers on the sleeping animal brain, but also because it lends support to the idea that sleep plays a critical role in the encoding and storage of memories. The study demonstrates, for the first time, that episodic memories are being replayed or "rehearsed" in the hippocampus during sleep, perhaps representing a process by which memory is gradually consolidated and passed to other parts of the brain, a model championed by several researchers.

"I am delighted," said Dr. Allan Hobson, a professor of psychiatry at Harvard and the director of the Laboratory of Neurophysiology at the Massachusetts Mental Health Center in Boston, "because it suggests that, as we have long suspected, sleep has a lot of functional significance for learning and memory."

The relationship between sleep and memory is still debated within the field, but studies by Dr. Robert Stickgold, of Dr. Hobson's lab, and others indicate that when people learn new skills, their performance is dependent on how much they get of two types of sleep: Nondreaming or slow-wave sleep early in the night, and so-called rapid eye movement, or R.E.M., sleep later in the night. In humans, R.E.M. sleep is when most dreaming occurs.

The new work is particularly exciting, Dr. Hobson and other scientists said, because the sophisticated technology used by the researchers opens new possibilities for understanding the biology of sleep. Such studies, which involve implanting electrodes in animals' brains, cannot be done in humans for obvious ethical reasons.

Like humans, slumbering animals pass through different stages of sleep, and most mammals exhibit periods of R.E.M. sleep, characterized by intense activity in the brain and rapid movements of the eye. The rat, Dr. Wilson said, which has a 12-hour sleep cycle, generally passes through R.E.M. about every 20 minutes, with each R.E.M. episode lasting for an average of 2 minutes.

In the study, Dr. Wilson and Kenway Louie, a biology graduate student, first trained the rats to run through the maze. The rats received a reward when they reached a point three-fourths of the way around the circle. Electrophysiological activity from clusters of neurons in the hippocampus was then recorded using multiple electrodes made from fine wire, surgically implanted in the rats' brains. Recordings were taken while the rats ran through the maze, and during periods of sleep before and afterward.

In previous work, Dr. Wilson and other researchers had found that while rats were running a maze, hippocampal neurons fired in specific patterns, producing a "unique signature of the behavioral experience." The pattern was distinct from that produced when the rats ran a different maze, when they ran the same maze under different conditions, or when they engaged in random activity.

"Due to the repetitive nature of the task," the researchers wrote, "such patterns of activity were consistently repeated throughout a given session. The repeated activation of these robust patterns led us to hypothesize that such patterns may be good candidates for subsequent reproduction during sleep."

In fact, of the 45 R.E.M. episodes, each lasting between 60 seconds and 250 seconds, recorded by the researchers while the rats slept, 20 contained a replication of the signature maze-running pattern.

The pattern also could be seen during periods of slow-wave sleep, the researchers found, most commonly in periods after the animals had run the maze. In R.E.M. sleep, the pattern was most likely to appear before the rats' daily maze-running session, 24 hours or more after they had last negotiated the task. Of 38 R.E.M. episodes recorded before the sessions, 19 reproduced the pattern.

Dr. Wilson speculated that the more frequent appearance of the firing sequences in R.E.M. episodes before the rats ran the maze might mean that R.E.M. is "more precisely concerned with the remote past," involving a reevaluation of past experience, rather than a simple translation of events that recently occurred. The repetition during slow-wave sleep, he suggested, might reflect the processing of more recent memory.

On the other hand, Dr. Wilson said, the differences might simply reflect that fact that the rats were sleeping more deeply in the R.E.M. episodes recorded before running the maze. Other scientists, however, said that the relative paucity of pattern reproductions during periods after the maze was run was a weakness of the study.

While the study is the first to document the replaying of long sequences of remembered experience, it builds on work of a decade ago by Dr. Jonathan Winson and his colleagues, which demonstrated that single neurons in the rat's hippocampus were reactivated during sleep as a result of experiences during waking.

In future studies, Dr. Wilson and his colleagues hope to extend their work to other parts of the brain, for example, examining activity in areas responsible for sensory experience, like sight and even smell.

The eventual result, he said, might be "a kind of animal correlate of Freudian psychoanalysis," a method for exploring how waking life influences the complexity and content of dreams, and how dreaming affects memory and performance during wakefulness.

And though the dreams of the laboratory rats turned out to be somewhat prosaic, Dr. Wilson said, this could be simply because they tend to lead boring lives.

"It's not necessarily that rodents have simpler dreams," he said, "but we limit them by restricting the experiences they have. It might be that a wild subway rat's dreams are as exciting as our epic adventures in sleep."

Still, it will be a while before the family dog is recounting his exploits in the arms of Morpheus at the breakfast table, or the neurotic feline next door is sent for sessions on the analytic couch.

Dr. Daniel Dennett, a philosopher at Tufts University who has written about the animal mind, said that "the next step is to see what if anything these animals can do with this. If the replay is prevented does it hurt their performance? Can they facultatively turn this on, the way we can dredge up a recollection of what happened last Sunday?"

"What I call the hard question," Dr. Dennett said, "is always, `And then what happens?"'


News Brief: Study of Rats In Maze Suggests Brain Stores Information in Chunks

A rat navigating a maze keeps track of where it's been and where it's going using the area of the brain called the hippocampus and updates its path eight times a second, say researchers from Carnegie Mellon University and the University of Minnesota in a study published online June 17 by the journal Nature Neuroscience.

Anoopum Gupta, who earned his Ph.D. in robotics at CMU in 2011 and is now pursuing his M.D. at the University of Pittsburgh School of Medicine, said the rat's neural activity patterns represent a short path that begins just behind and extends just ahead of the rat. The length of the path, and the relative length in front and behind the animal, changes depending on the rat's behavior, including its speed, the presence of landmarks and whether the rat is deliberating which way to go.

The hippocampus plays a central role in episodic memory, navigation and episodic future thinking. A number of researchers have explored possible mechanisms for how the hippocampus encodes and recalls experiences and the findings from this study of six trained rats adds insight and evidence regarding a possible mechanism, Gupta said.

Moreover, the study provides the first evidence that the hippocampus may play a role in "cognitive chunking," the idea that the brain collects information into discrete units that can be efficiently stored and recalled, he added.

When a rat would pass a landmark, neural activity patterns showed that the hippocampus represented more space in front of the animal when a rat approached a landmark, more space was represented behind the animal. This suggests that the hippocampal firing patterns represented segments of space that were between important landmarks, potentially allowing those segments to be discretely stored in the brain.

In addition to Gupta, the researchers include Carnegie Mellon Computer Science Professor David S. Touretzky and A. David Redish, professor of neuroscience at the University of Minnesota and Matthijs van der Meer, assistant professor of biology at the University of Waterloo.

Previous work by this group of researchers, published two years ago in the journal Neuron, showed that rats at rest often would replay their experiences in a maze in a way suggesting that they weren't building memories so much as creating maps that would help them make better navigation decisions.

Gupta and his colleagues used electrodes attached to the rats to monitor certain neurons, called place cells, that fire in response to physical locations. Understanding how the activity of individual neurons enables the brain to perform cognitive functions may someday lead to mechanism-driven methods for treating neurocognitive disorders, Gupta said, while deeper knowledge of how animals navigate may provide roboticists clues for improving autonomous navigation systems.

Carnegie Mellon University
5000 Forbes Avenue
Pittsburgh, PA 15213
412-268-2900


2. MATERIALS AND METHODS

2.1. Experimental animals

Sprague�wley rats were used in this study (Experimental Animal Center, Zhejiang University, China). They were maintained in cages with a 12 hours light�rk cycle (lights on from 8:00 to 20:00) with free access to food and water. Five rats were raised in one cage after weaning, and they were separated when they were 60ꃚys old in order to perform the behavior test. This study was performed with the approval of the local ethical committee, and all the experiments were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

2.2. Generation of experimental complex FSs

Day of birth was considered as postnatal day 0 (P0). Experimental FSs were induced as we previously described in rat pups on P10. 9 , 13 , 14 Briefly, the body temperature of the pups was raised in a chamber with an ambient temperature of 42�ଌ. Core temperature was measured at baseline (34.1 ±਀.7ଌ) and seizure onset (40.3 ±਀.7ଌ). Pups were moved to a cool surface for 2 minutes once seizure was evoked and then returned to the chamber. The behavioral seizures induced by hyperthermia were correlated with EEG seizures and stereotyped, consisting of sudden movement arrest followed by facial automatisms (chewing), forelimb clonus, and tonic flexion of the body, often associated with a loss of postural control. The hyperthermia was maintained for

90 minutes (typically 40� minutes of seizures) for 10FS and

60 minutes (typically 15� minutes of seizures) for 4FS rats. After hyperthermia, pups were weighed and moved to a cool surface until core temperature fall within the normal range for age, and then returned to the home cage.

The rat pups were divided into four groups as follows: (a) four FSs within 30 minutes (4FSs) (b) ten FSs within 60 minutes (10FSs) (c) hyperthermia control (H), which subjected to ten episodes of hyperthermia along with 10FSs group, but seizures were prevented by pretreatment of pentobarbital (20 mg/kg, ip) and (d) controls (CON), which were removed from the cage along with FSs groups during the experiment but were maintained in the normal environment.

The body weight of FSs rats and control rats were measured every day from 7ꃚys old to 60ꃚys old. Then, the behavioral experiments were performed at about P60, and the rats were tested over few days. The same cohorts of rats were used for different behavioral tests to minimize the use of the number of rats. The interval time of two behavioral tests was 1𠄂 weeks. We used rats from different mothers to perform the same behavioral tests (about 2𠄃 L from the same mother).

2.3. Offspring generation

Sixty�y‐old F0 generation rats were allowed to mate. F1 generation rats were born when the F0 rats of

90ꃚys old were used. Then F1 generation rats were mated to have their offspring (F2 generation). To reveal which parent contributed to the transgenerational transmission, FSs females were mated with non𠄏Ss males and vice versa.

2.4. Cross𠄏ostering

All litters were cross𠄏ostered on P2 according to age, dam availability, and birth date concordance. 15 Litters were culled to 7𠄈 pups for homogeneity. Four groups were obtained as follows: (a) pups born from FSs dams but were adopted by normal dams (FS (F1)𠄌ON (F0)) (b) pups born from FSs dams and were adopted by FSs dams (FS (F1)𠄏S (F0)) (c) pups born from normal dams and were adopted by FSs dams (CON (F1)𠄏S (F0)) (d) pups born from normal dams and were adopted by normal dams (CON (F1)𠄌ON (F0)).

2.5. Locomotor activity

Locomotor activity was recorded in an open𠄏ield arena with a camera connected to a tracking system. The protocol was simplified from previous report 17 : P60 rats were placed individually in the center of an open circular arena (100 ×򠄀 ×ꁀ਌m) located in a sound𠄊ttenuated, temperature controlled room. The rats were maintained in the arena for 30 minutes. Their exploratory activities were videotaped, and behavior analyses were performed by an expert observer without knowledge of the treatments given.

2.6. Morris water maze

On around P60, rats underwent the Morris water maze to assess hippocampus�pendent spatial memory. 16 In brief, on days 1 to 4, rats were given 24 training sessions (six per day) to escape onto the submerged platform. On day 5, platform was removed, and rats were placed in the quadrant opposite to the previous platform position. The rats were allowed 60 seconds of free swimming. The time in target quadrant and the number of crossings in the target area were recorded.

2.7. Inhibitory avoidance task

The single‐trial inhibitory avoidance task, another hippocampus�pendent behavior test, was used to measure different phases of memory in adult rats. In the training phase, rat was placed in the illuminated compartment. The door was opened 2 minutes later and was closed when the rat entered the dark compartment. Rat was given a 1.0 mA/s shock and then was removed from the alley and returned to its home cage. The rat was placed in the illuminated compartment 24 hours later, and the latency to step into the dark compartment was recorded as the measure of retention performance. Rat that did not enter the dark compartment within 600 seconds was removed from the alley.

2.8. Contextual fear conditioning

In a typical experiment, the rat was placed in a fear conditioning apparatus. 17 After the initial adaptation, a foot shock (1 seconds, 0.5 mA) was given, and this process repeats for three times. Rat was placed in the same apparatus 24 hours after training. Freezing times in response to representation of the context were measured every 5 seconds in 5 minutes.

2.9. Enrichment protocol

Siblings were divided equally between test and control cohorts. Enriched environment (EE) included an enriched cage (60 ×ꁠ ×ꁠ਌m) containing plastic play tubes, cardboard boxes, running wheel, various pet toys, and nesting material that were all changed or rearranged every other day to provide novel stimulation. The EE group consisted of 21�y‐old FSs or control rats that explored the enriched cage for 6 hours per day for 14ꃚys. Age‐matched animals were housed three to four per cage in standard cages containing only pine chip bedding. The rat pups were randomly divided into four groups as follows: (a) control rats in normal environment (CON‐N) (b) control rats in enriched environment (CON𠄎) (c) 10FSs rats in normal environment (10FSs‐N) (d) 10FSs rats in enriched environment (10FSs𠄎).

2.10. DNMT inhibitor treatment

Zebularine (Sigma, St. Louis, MO, USA, Z4775) was dissolved in 10% DMSO and diluted to a concentration of 2 mg/mL in sterile saline. 5𠄊za𠄂′�oxycytidine (Sigma, A3656) was dissolved in 0.8% acetate and diluted to a concentration of 1 mg/mL in sterile saline. Rats of P10 were given 0.1 mL DNMT inhibitor (ip) immediately after FSs and then daily for the following 5ꃚys. 18

2.11. Protein extraction

Protein extractions were performed from adult male or female rats (P60), which have not yet been tested in water maze test, inhibitory avoidance task or contextual fear conditioning. Rats were deeply anesthetized with ethyl ether and perfused transcardially with 0.9% saline. Animals were decapitated, and the hippocampus, testis or ovaries were quickly isolated. The collected tissues were homogenized in RIPA buffer (pH 7.5, in mmol/L 20 Tris‐HCl, 150 NaCl, 1 EDTA, 1% Triton‐X100, 0.5% sodium deoxycholate, 1 PMSF, and 10 μg/mL leupeptin). Centrifuge for 30 minutes at 12000 rpm and collect the clear supernatant into a new tube. Determine protein concentration with a dilution.

2.12. Western blotting

Protein extracts were separated by SDS‐PAGE on a 7.5% resolving gel with a stacking gel and transferred onto nitrocellulose membrane.Blots were placed in 5% skim milk for 1 hours at room temperature, and then incubated with primary antibody (diluted in TBS/0.05% Tween) overnight at 4ଌ. Subsequently, the blots were washed and probed with the respective horseradish peroxidase𠄌onjugated secondary antibody (Odyssey, LI𠄌OR, MultiSciences, Hangzhou, China, 1:5000 dilution) for 2 hours at room temperature. The immunoreactive bands were visualized using the ECL detection reagent (Millipore, Billerica, MA, USA). 19 , 20 The following primary antibodies were used: anti𠄍NMT1 (1:1000, Cell Signaling Technology, Danvers, MA, USA, D63A6), anti𠄍NMT3A (1:1000, Abcam, Cambridge, UK, ab113430), anti𠄍NMT3B (1:1000, Abcam, ab79822), anti‐Reelin (1:1000, Abcam, ab18570), anti‐protein phosphatase 1 (PP1) (1:1000, Cell Signaling Technology, #2582), anti‐β�tin (1:1000, Santa Cruz Biotechnology, Dallas, TX, USA, sc47778).

2.13. RT‐PCR

RNA extractions were performed from adultmale or female rats, which have not yet been tested in water maze test, inhibitory avoidance task or contextual fear conditioning. RNA was isolated from the hippocampus using Trizol (Invitrogen Carlsbad, CA, USA). First‐strand cDNA synthesis was carried out using 2 μg total RNA with reverse transcriptase. SYBR green was used to monitor amplification of template with primers on a real‐time thermal cycler. 21 The following PCR primers were used for RT‐PCR analysis: DNMT1: forward 5′‐GGGTCTCGTT CAGAGCTG and reverse 5′‐GCAGGAATTCATGCAGTAAG DNMT3A: forward 5′�GCGTCACACAGAAGCATATCC and reverse 5′‐GGTCC TCACTTTGCTGA ACTTGG DNMT3B: forward 5′‐GAATTTGAGCAGCCCAGGTTG and reverse 5′‐T GAAGAAGAGCCTTCCTGTGCC 22 reelin: forward 5′�GGGAGATTGGGTG ACG and reverse ACGTGCTTCTGGATGGTTTC PP1: forward TCCATGGAGCA GATTAGACG and reverse GCTTTGGCAGAATTGCGG β�tin: forward 5′‐G TGGGCCGCTCTAGGCACCAA and reverse 5′𠄌TCTTTGATGTCACGCACGATT TC.

2.14. DNA methylation assay

DNA extractions were performed from adult male or female rats, which have not yet been tested in water maze test, inhibitory avoidance task or contextual fear conditioning. Purified DNA was then processed for bisulfite modification (CpGenome DNA modification kit Chemicon Billerica, MA, USA). Semiquantitative real‐time PCR was used to determine the DNA methylation status of the reelin and PP1 genes. Methylation‐specific PCR primers were designed according to previous research. 23

Detection of unmethylated reelin DNA was performed using the following primer: forward (5′‐TGTTAAATTTTTGTAGTATTGGGGATGT𠄃′) and reverse (5′‐TCCTTAAAATAATCCAACAACACACC𠄃′). Detection of methylated reelin DNA was performed using the following primer: forward (5′‐GGTGTTAAATTTTT GTAGTATTGGGGAC𠄃′) and reverse (5′‐TCCTTAAAATAATCCAACAACACGC𠄃′). Detection of unmethylated PP1 DNA was performed using the following primer: forward (5′‐GAGGAGAGTTTGGTGTTTATAA GATGGT𠄃′) and reverse (5′‐TCC TCCAAAAACTCAACTCAAACAA𠄃′). Detection of methylated PP1 DNA was performed using the following primer: forward (5′‐GGAGAGTTTGGTGTTTATAA GATGGC𠄃′) and reverse (5′𠄌GAAAACTCGACTCGAACGA𠄃′). Samples were normalized to β‐tubulin 4 using following primer: forward (5′‐GGAGAGTAAT ATGAATGATTTGGTG𠄃′) and reverse (5′�TCTCCAACTTTCCCTAACCTAC TTAA𠄃′).

2.15. Statistical analysis

Data were expressed as mean ± SEM. Two‐tailed unpaired t test was used for two‐group comparison, and One‐way ANOVA (analysis of variance) with Dunnett's post hoc test was used for multiple comparisons. A two‐tailed P <਀.05 was considered statistically significant.


High fat diet during pregnancy slows learning in offspring, rat study suggests

In a bid to further explore how a mother-to-be's diet might affect her offspring's brain health, Johns Hopkins Medicine researchers have found that pregnant and nursing rats fed high fat diets have offspring that grow up to be slower than expected learners and that have persistently abnormal levels of the components needed for healthy brain development and metabolism.

In the experiments, pregnant rats were allowed to overeat repeatedly a diet similar in fat to that of typical fast food meals that people eat. Although the study was performed on animals, the researchers say their findings -- described in the August issue of Experimental Neurology -- likely apply in some measure to other mammals including humans, and they add to evidence that unhealthy diets may damage a fetus's developing brain in specific ways.

Because so much of mammalian brain biology and metabolism is similar, the research "may well hold warnings for people that high fat diets during pregnancy are a concern," says Kellie Tamashiro, Ph.D., M.S., associate professor of psychiatry and behavioral sciences at the Johns Hopkins University School of Medicine. "Pregnant moms who may not have access to fresh foods or healthy diets may have their unborn children's brain development suffer, and there's an opportunity to intervene to change their offspring's learning trajectory to a better one."

Tamashiro's laboratory studies how, during pregnancy, stress, diet and the immune system can contribute to neuropsychiatric and metabolic diseases such as diabetes. During the current study, which focused on the impact of a high fat diet on the developing brain, they fed pregnant rats a diet of 60% calories from fat in their food pellets throughout pregnancy and until their pups were finished weaning -- a period of three weeks. The typical American and Western European diet has about 45% calories from fat. The researchers compared the rats' high fat food to a fast food diet.

"The pregnant rats had free access to a very high fat diet where they were eating as much as they wanted and they did overeat, just like we do in Western society," says Zachary Cordner, M.D., Ph.D., chief resident of psychiatry at The Johns Hopkins Hospital and the study's lead author.

When the offspring were finished weaning, at about 21 days after birth, they were fed for the next three months a normal rat chow diet in which 20% of the calories came from fat. At about 4 months of age, the adult rats were evaluated for their learning and memory abilities using a maze that consisted of a round platform with 20 holes around the perimeter, only one of which led to an exit.

The researchers note that rats don't like wide-open spaces, because such an environment exposes them to predators in the wild, so they would instinctively seek to exit the open platform. Normal rats consistently take three to four tries to learn where the maze exit is, but rats from mothers fed the high fat diets took up to nine times to learn the location.

A week after learning the exit location, the rats were tested again. Those born to mothers on a normal diet remembered the maze and only took about five seconds to find the exit, but the rats whose mothers had a high fat diet took about 20 seconds on average.

In a second set of experiments, the team exploited the fact that normally, rats are curious and like to check out new objects in their environment. When they familiarized rats with Lego blocks and then swapped one of the known blocks with a different one the next day, the rats typically spent more time exploring the new one. But rats from mothers who were fed the high fat diets spent just as much time around the familiar object as they did the new one, suggesting they didn't recognize the object as new.

"The rats from moms fed high fat diets were slow learners," says Cordner. "They were able to learn as well as the normal rats, but it took them longer to do it."

To figure out what might have accounted for the slow learning, the researchers compared the levels of products made by genes in the brains of normal rats with the levels in rats whose mothers were fed high fat diets during pregnancy and nursing. They focused on the part of the brain that is vital to learning and memory just when the pups were finished weaning and a few months later when the rats were adults.

The rats from pregnant mothers that were fed high fat diets had lower levels of insulin receptors, leptin receptors and glucose transporter 1 than did rats that came from mothers fed normal diets.

Insulin helps regulate blood sugar. In rats and all mammals, the insulin receptor detects insulin and initiates the process to help get sugar out of the blood -- using the glucose transporter -- and into the body's cells for energy. Leptin is a hormone that suppresses hunger, and it binds to the leptin receptor to regulate body weight and metabolism.

"The roles of genes involved in energy metabolism affect learning and memory too, and this role changes over time," says Cordner. "Initially, these genes are involved in the formation of the fetal brain, and later on in life they are involved in learning and memory, in addition to energy metabolism.

"Our findings build on what we already know about the role of these hormones and nutrients on brain health, and clearly support the idea that a high fat diet does impact neuropsychiatric risk that carries over into adulthood, most likely by interfering with how genes are regulated and expressed," adds Cordner.

Other authors of the paper include Seva Khambadkone, Gretha Boersma, Lin Song, Tyler Summers and Timothy Moran of Johns Hopkins.

This study was supported by the Greif Family Scholarship Endowment, the Eunice Kennedy Shriver National Institute of Child Health and Human Development (HD093338), National Institute of Mental Health (MH108944) and Dalio Philanthropies.

The authors don't have any conflicts to report.

Disclaimer: AAAS and EurekAlert! are not responsible for the accuracy of news releases posted to EurekAlert! by contributing institutions or for the use of any information through the EurekAlert system.


Abstract

Prenatal exposure to nicotine can cause many fetal developmental problems. This study determined the influence of nicotine during pregnancy on the development of cognitive behavior in the offspring.

Nicotine was administered to pregnant rats through implanted osmotic mini-pumps at 6mg/kg/day and flow rate of 60 μl/day for whole pregnancy from gestational day 4. Fetal and offspring body and brain weight was measured. Learning and memory were tested in adult offspring with Morris water maze Learning and memory-related receptors were measured.

The results showed that exposure to prenatal nicotine (PN) not only caused fetal growth restriction, but also had long-term effects on learning and memory in the offspring. The PN offspring exhibited longer escape latency regardless of sex. The number of passing the platform was significantly less in the PN offspring than that of the control. The expression of messenger RNA (mRNA) and protein of N -methyl- D -aspartic acid receptor (NMDAR) in the hippocampus was significantly increased, whereas alpha7 nicotinic acetylcholine receptor (α 7 nAChR) protein was decreased with unchanged α 7 nAChR mRNA in the PN offspring.

The data provided novel information on the PN-affected development in learning and memory in the offspring, suggesting that α 7 nAChR and NMDAR1 in the hippocampus might be the targets for actions of PN in association with memory impairment.


Watch the video: Αρουραίος ήρωας που εντοπίζει νάρκες βραβεύεται με μετάλλιο γενναιότητας (August 2022).