Information

Luciferase promoter vector over p-AcGFP1-C1 vector

Luciferase promoter vector over p-AcGFP1-C1 vector



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

AcGFP1 vector can emit light by itself, whereas in case of Luc vector a substrate is needed for the reaction. Nevertheless, Luc is said to be more specific or better than AcGFP1. Why is this so called? What are the advantages of Luc vectors over AcGFP1?


You are confusing luminescence and fluorescence. GFP does not emit light. The abbreviation stands for Green Fluorescent Protein. You need to shine a blue light source at it and it will fluoresce green. The problem is that many organisms have background fluorescence, a cell without any GFP can often have a little bit of fluorescence by itself or contain pigments that mask the signal.

Luciferase assays depend on a chemical reaction which oxidises a molecule (luciferin in the case of firefly luciferase) and photons are emitted. This is much more sensitive than fluorescence but is also a lot more expensive and usually (but not always) requires cell lysis. It is very rare for a cell to emit light by itself so the background will be a lot lower allowing you to see smaller difference.

There are many reasons to choose one over the other in an assay, if you share a bit more on how you intend to use the reporter you can get a more detailed answer.


The vector to use will depend on what you want to do.

The possible problems with GFP are :

  • The lost of function of the fusion protein (you add 238 amino acids to your protein, that's a rather big change !). There are vectors allowing fusion in C- or N- ter of your protein to try to avoid that.

  • The GFP may separate from its fusion protein, making observations or immunoprecipitations useless.

  • With a high expression vector, you may have a saturation of fluorescence in your cells so quantification would be difficult.

With luciferase assay, you add the substrate so your quantifications can be made as soon as the reaction start and luminometers are sensitive enought to detect very low Luc activity or use very few cells.

BUT

GFP vectors allows you to do in vivo assays (quantification, intracellular localisation, cell sorting… ) while Luc assays needs the lysis of your cells. So, depending of your goal it will be better to use one system or the other.


Development of a therapeutically important radiation induced promoter

Radio-genetic therapy is a combination of radiation therapy and gene therapy that may solve some of the problems associated with conventional radiotherapy. A promoter responsive to radiation was obtained from a promoter library composed of DNA fragments created by linking the TATA box signal to randomly combined binding sequences of transcription factors that are reactive to radiation. Each promoter connected to the luciferase gene, was evaluated by luciferase expression enhancement in transfected cells after X-ray irradiation. The reactivity of the best promoter was improved by the random introduction of point mutations and the resultant promoter showed more than a 20-fold enhancement of the luciferase expression after X-ray irradiation at 10 Gy. The expression of downstream genes was also enhanced in stably transfected cells not only by X-rays but also by proton beam irradiation and either enhancement was attenuated when an anti-oxidant was added, thus suggesting the involvement of oxidative stress in the promoter activation. Constructed promoters were also activated in tumors grown in mice. In addition, cell killing with the fcy::fur gene (a suicide gene converting 5-fluorocytosin to highly toxic 5-fluorouracil) increased dose-dependently with 5-fluorocytosin only after X-ray irradiation in vitro. These results suggest that promoters obtained through this method could be used for possible clinical applications.


Genome Engineering

Although overexpressing or knocking down a gene can tell you much about its function and/or alter cellular activity in a way that’s interesting from an applied perspective, sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome itself. Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting the use of cellular resources required for the production of large amounts of protein or high copy number plasmids. Whether you're studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic compound, there are many different ways to alter bacterial genomes. From recombineering to CRISPR, this collection contains a variety of tools to help you harness bacterial genomes for your research.

Plasmid ID Technique PI Purpose
pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9 nuclease gRNA. For a more comprehensive list of our bacterial CRISPR plasmids, see here.
pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline inducible expression of wild-type Cas9 from S. pyogenes for inducing double stranded breaks. For a more comprehensive list of our bacterial CRISPR plasmids, see here.
pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of customizable guide RNA (gRNA) for bacterial gene disruption or knockdown. For a more comprehensive list of our bacterial CRISPR plasmids, see here.
pGRG Series Various Plasmids Tn7 Transposition Nancy Craig A gene of interest cloned into one of these plasmids can be transposed into the attTn7 attachment site found in many enterobacterial genomes. The bacteria of interest are transformed with the appropriate construct, grown at the permissive temperature (32°C) to allow transposition, and the construct is then cured by growing at the non-permissive temperature (42°C). Transposition is efficient enough that selection is not required.
pET-HIS-Sangamo 40786 TALEN Gang Bao Gateway cloning and expression of an N-terminally His-tagged TALEN fused to an E. coli codon optimized FokI endonuclease domain.
pET-Sangamo-His 40787 TALEN Gang Bao Gateway cloning and expression of a C-terminally His-tagged TALEN fused to an E. coli codon optimized FokI endonuclease domain.

Measuring luciferase expression using the SpectraMax Glo Steady-Luc Reporter Assay Kit

The use of gene reporters such as luciferase permits highly sensitive and nondestructive monitoring of gene expression. Firefly luciferase, a 61 kD monomeric protein, is especially attractive to many researchers because of its high sensitivity, wide linear detection range and extremely low background due to the absence of endogenous luminescent activity in mammalian cells. For the increasingly popular assay using luminescence microplate readers, the high-throughput compatible “glow” assay is often preferred for batch processing of multiple plates. In this application note, we demonstrate the measurement of luciferase expression in CHO-K1 cells using the SpectraMax ® Glo Steady-Luc™ Reporter Assay Kit, which affords longlasting luminescence signals. This assay kit is optimized for the SpectraMax ® i3x Multimode Microplate Reader with a preconfigured protocol in SoftMax ® Pro Software for rapid data analysis.

Materials

  • SpectraMax Glo Steady-Luc Reporter Assay Kit, Molecular Devices (Explorer kit #R8352 or Bulk kit #R8353)
  • Competitor kit: Steady-Glo Luciferase Assay System, Promega (Cat# E2510)
  • SpectraMax i3x Microplate Reader, Molecular Devices (Cat# i3X)
  • 96-well white walled clear bottom plates, Costar (Cat# 3903)
  • Purified luciferase, Promega (Cat# E1701)
  • 384-well solid white plates, Greiner (Cat# 655075)
  • CHO-K1 cells, ATCC (Cat# CCL-61)
  • Complete Growth Media
    • Ham’s F12 Medium, Life Technologies (Cat# 11765-54)
    • Fetal Bovine Serum, Gemini (Cat# 100-106)
    • Penicillin/Streptomycin, Life Technologies (Cat# 15070-063)

    Methods

    The SpectraMax Glo Steady-Luc Reporter assay has a simplified workflow. The working solution is mixed at 1:1 ratio with the medium in each well of the microplate, where cells expressing luciferase are plated. The plate is then covered and mixed to allow complete cell lysis before the luminescent signals are read on the SpectraMax i3x Multimode Microplate Reader (Figure 1). The data acquisition and analysis is easily streamlined when using the preconfigured protocol in Softmax Pro Sofware.

    Figure 1. SpectraMax Glo Steady-Luc Reporter Assay Kit workflow.

    Luciferase standard curve

    To identify the linear detection range of this assay, a standard curve was constructed to measure the RLU as a function of luciferase concentration. All components of the SpectraMax Glo Steady-Luc Reporter Assay Kit were first allowed to equilibrate to room temperature. SpectraMax Glo Steady-Luc working solution was made by adding D-Luciferin to the Steady-Luc Assay buffer in a 1 mg to 4 mL ratio. A ten-fold serial dilution of purified luciferase in PBS with 0.01% BSA starting at a concentration of 1 x 10 6 fg/well was prepared, and 25 μL of each concentration was added in triplicate to a 384-well solid white plate. Afterwards, 25 μL SpectraMax Glo Steady-Luc working solution was added to the wells containing luciferase and controls. The plate was shaken and incubated in the dark for 10 minutes. Using the SpectraMax i3x reader, the preconfigured SpectraMax Glo Steady-Luc Reporter assay protocol in SoftMax Pro Software was used to measure luminescence. After detection, the protocol automatically generates a curve of the data.

    Transfection and cell-dilution assay

    Part of assay development for a reporter gene assay is to optimize the cell number and amount of plasmid necessary to give a robust signal for screening. A cell dilution assay was performed with two different amounts of pGL4.13 firefly luciferase starting in 6-well plates. CHO-K1 cells were transiently transfected with 1.7 μg or 0.8 μg per well of pGL4.13[luc2/SV40] vector, which encodes the luciferase gene luc2 under control of the SV40 early enhancer/promoter, or pGL3-Basic (control) vector, which lacked promoter and enhancer sequences. After 24 hours, cells were trypsinized and seeded at 100 μL/well into a 96-well plate starting at 30,000 cells/well with subsequent 2-fold dilutions. 100 μL/well Steady-Luc working solution was added to the wells. The plate was covered to protect the reagents from light and mixed using an orbital shaker. After 10 minutes, luminescence was measured and recorded on the SpectraMax i3x reader using the preconfigured SpectraMax Glo Steady-Luc Reporter assay protocol. The preconfigured protocol is found in the Reporter Assays section under the Protocol Library Tab or on the SoftMax Pro Software protocol sharing website (www.softmaxpro.org).

    Screening applications

    A reporter gene assay screen was simulated by performing multiple reads of a plate of pGl4 firefly luciferase transfected cells using the SpectraMax Glo Steady-Luc Reporter Assay Kit. Cells were transfected as previously described and plated at 30,000 cells per well in a 96-well plate and grown overnight. On the day of the assay, the plate was equilibrated to room temperate, and then 100 μL reconstituted Steady-Luc working solution containing D- Luciferin was added to each well. The plate was covered and mixed on an orbital shaker for five minutes and then placed In a SpectraMax i3x reader and mixed. Luminescence was read every five minutes for a total of five hours with three seconds of orbital shaking before each read.

    Results

    Luciferase standard curve

    For comparison, the standard curve to identify the detection range of the assay was also performed with a competitor’s glow luciferase assay. In both cases, the assays identified a linear relationship between luminescence and luciferase concentration (Figure 2). The R2 values for luciferase were 0.998 using the SpectraMax Glo Steady-Luc Reporter Assay Kit and 0.999 using the competitor assay kit. A paired t-test of normalized data indicates equivalent results at each concentration (P < 0.05). Calculations were performed using GraphPad Prism. Using both kits, the Lower Limit of Detection (LLD) of luciferase was 5 femtograms/well in 384-well format.

    Figure 2. Luciferase standard curve in 384-well format. Linear results from a 10-fold dilution of purified luciferase in either the SpectraMax Glo Steady-Luc Reporter assay (Green) (R2 = 0.999) or a competitor assay (Red) (R 2 = 0.998). In both assays the LLD = 5 femtogram/well.

    Measurement of luciferase in transfected cells

    Titration of CHO-K1 cells transiently transfected with luciferase starting at 30,000 cells/well was pipetted into the wells followed by Steady-Luc Reporter working solution. Shown in Figure 3, both the SpectraMax Glo Steady-Luc Reporter assay and competitor glow luciferase assay demonstrated a linear relationship between cell number and luminescence. For cells that received 0.8 μg of pGL4.13 luciferase vector, R 2 = 0.995 using the SpectraMax Glo Steady-Luc Reporter Assay Kit and R 2 > 0.999 using the competitor assay kit. Both kits detected the lowest dilution of cells tested in the assay, 468 cells/well.

    Figure 3. Measurement of luciferase in transfected cells. 90% confluent CHO-K1 cells were transfected with either 1.7 μg pGL4 (Firefly) (Red), 0.8 pGL4 (Firefly) (Green), or pGL3 (control) luciferase plasmids (Blue). (A) SpectraMax Glo Steady-Luc Reporter assay (R 2 >0.995 at 0.8 μg plasmid) and (B) Competitor assay (R2 = 0.999 at 0.8 μg plasmid). Both kits detected the lowest number of cells/well in the assay (468 cells/well).

    Screening applications

    The SpectraMax Glo Steady-Luc Reporter assay is a glow-based luminescence assay that provides an extended signal time window (Figure 4). A plate with luciferase expressing CHO-K1 cells at 30,000 cell/well is read every five minutes to simulate batch processing of screening plates. At five hours, the signal is within 20% of the initial value. On each individual plate in a reporter assay screen, a control for normalization of data to background is included so that data can be compared across many plates. As demonstrated in Figure 5, the signal stays within 15% across 20 plates, suggesting the feasibility of running 20 plates in a 90 minute period with this assay.

    Figure 4. Luciferase signal in CHO-K1 cells over time. CHO-K1 cells were transfected with luciferase. On the day of the assay, the plate was equilibrated to room temperature, and then 100 μL reconstituted Steady-Luc working solution containing D-Luciferin was added to each well. The plate was covered and mixed on an orbital shaker for five minutes and then placed in a SpectraMax i3x reader and mixed. Luminescence was read every five minutes for five hours with three seconds of orbital shaking before each read.

    Figure 5. Screening applications. Raw data from luciferase transfected CHO-K1 cells in the SpectraMax Glo Steady-Luc assay. The average signal from the luciferase transfected cells is plotted as an example of batch processing during a screening assay in which a plate is read every five minutes. On screening plates, background controls are used to normalize data so that comparisons can be compared across many plates.

    Conclusion

    Luciferase-based reporter assays using luminescence microplate readers have become increasingly popular for high-throughput analysis of chemical biology and drug discovery applications. The SpectraMax Glo Steady-Luc Reporter assay kit allows for sensitive quantification of firefly luciferase expression in mammalian cells. By applying a homogeneous experimental protocol, the specially formulated mixture of substances in this kit significantly extends the time window with steady signal, thereby enabling batch processing of plates in screening assays. This assay kit is optimized for SpectraMax microplate readers from Molecular Devices, with a pre-configured protocol provided for customers using Molecular Devices’ SoftMax Pro Software for their data acquisition and analysis.


    Reporter Gene Vectors

    Vectors are plasmids, extrachromosomal elements, that carry reporter gene sequences for delivery into cultured cells. Not only do vectors provide the reporter gene, but may also have multiple cloning sites, promoters, response elements, polyadenylation sequences, mammalian selectable markers or other sequence elements that help with expression and selection. Reporter vectors are critical for success in reporter assays.

    PGL4 Luciferase Reporter Vectors Encoding Firefly and Renilla Luciferase

    Because vectors are used to deliver the reporter gene to host cells, regulatory sequences such as transcription factor-binding sites and promoter modules within the vector backbone can lead to high background and anomalous responses. This is a common issue for mammalian reporter vectors, including the pGL3 Luciferase Reporter Vectors. Our scientists applied the successful "cleaning" strategy described for reporter genes to the entire pGL3 Vector backbone, removing cryptic regulatory sequences wherever possible, while maintaining reporter functionality. In addition, the multiple cloning region was redesigned with a unique SfiI site for easy transfer of the DNA element of interest, the f1 origin of replication removed and an intron deleted. Furthermore, a synthetic poly(A) signal/transcriptional pause site was placed upstream of either the multiple cloning region (in promoterless vectors) or HSV-TK, CMV or SV40 promoter (in promoter-containing vectors). This extensive effort resulted in the totally redesigned and unique vector backbone of the pGL4 Vectors. There are also a series of pGL4 Vectors with partial deletions of the CMV promoter for nuanced usage of the strong promoter.

    The pGL4 family of luciferase vectors incorporates a variety of features such as your choice of optimized firefly or Renilla luciferase genes, Rapid Response™ versions for improved temporal response, mammalian selectable markers, basic vectors without promoters, promoter-containing control vectors and predesigned vectors with your choice of several response elements (Figure 6).

    Figure 6. The family of pGL4 Luciferase Reporter Vectors incorporates a variety of additional features, such as a choice of luciferase genes, Rapid Response&trade versions, a variety of mammalian selectable markers and vectors with or without promoters and response elements.

    PNL Vectors Encoding NanoLuc® Luciferase

    NanoLuc® luciferase is available in a variety of vectors for use in reporter gene assays of transcriptional control. These pNL vectors are based on the pGL4 vector backbone and thus offer many of the same advantages: Removal of transcription factor-binding sites and other potential regulatory elements to reduce the risk of anomalous results, easy sequence transfer from existing plasmids and a choice of several promoter sequences, including no promoter, minimal promoter and viral promoters. The family of vectors offer a choice of NanoLuc® genes (unfused Nluc, PEST-destabilized NlucP and secreted secNluc). These NanoLuc® gene variations are codon-optimized and have had many potential regulatory elements or other undesirable features such as common restriction enzyme sites removed.

    In addition, there are coincidence reporter vectors that encode both NanoLuc® and firefly luciferases on a single transcript. These vectors come with no promoter, a minimal promoter or CMV promoter for use in high-throughput screening. Study the rate of protein turnover of two key signaling proteins involved in response to cellular stress using reporter vectors.

    Reporter Vectors

    Our extensive line of state-of-the-art bioluminescent reporter vectors includes the pGL4 Vectors —the latest generation of firefly and Renilla luciferase reporter vectors, and the pNL Vectors, which contain the NanoLuc® luciferase reporter gene.


    Abstract

    Repeated bouts of ischemia in the heart lead to fibrosis and eventually to heart failure. Although certain genes, such as SOD or hemoxygenase and antisense to AT1R, ACE, and (β1-AR can provide short-term protection of the heart from ischemia, there is no known mechanism for constantly responding to repeated incidences of ischemia. We hypothesized that a “vigilant vector,” designed to be expressed specifically in the heart and switch on therapeutic genes only during hypoxia, would provide cardioprotection. To attain cardiac specificity, we inserted an MLC2v promoter into an adeno-associated virus (AAV) designed to deliver AS to AT1R and gfp. In in vitro experiments in cardiomyocytes (H9C2 cells), the MLC2v-AAV-gfp drove gene expression in all cells at levels comparable to a cytomegalovirus (CMV) promoter. In in vivo experiments, the rAAV-MLC2v-gfp was injected intravenously into mice or rats. Green fluoresence protein (GFP) DNA was located in kidney, heart (right and left ventricle), lung, adrenal and spleen. GFP mRNA, however, was expressed only in the heart and absent in other tissues. To switch on the rAAV transgene during ischemia, we inserted a hypoxia response element (HRE). This upregulates transcription when O2 levels are low. Thus, there are 4 components to the vigilant vector a gene switch (HRE), a heart-specific promoter (MLC2v), a therapeutic gene (AS-AT1R) and a reporter gene (gfp). To silence or lower basal level of expression while retaining specificity, we have reduced the length of the MLC2v promoter from 3 kb to 1775 bp or 281 bp. The truncated promoter is equally effective in heart specific expression. Preliminary studies with the rAAV-HRE-gfp in vitro show an increased expression in 1% O2 in 4 to 6 hours. By adding additional hypoxia-inducible factor (HIFα) (5 μg), the MLC2v-gfp expression is increased by 4-fold in 1% O2. Further amplification of the gene to 400-fold in 1% O2 can be achieved with a double plasmid. The construct may serve as a prototype “vigilant vector” to switch on therapeutic genes in specific tissue with physiological signals.

    The human heart can be subject to repeated bouts of hypoxia, which leads to silent or overt myocardial tissue damage. 1 Cumulatively, this can lead to heart failure. In an attempt to combat this with gene therapy we are proposing the development of a “vigilant vector,” inactive until switched on by hypoxia, that would protect the heart during ischemia with therapeutic genes. This concept requires the engineering of a stable vector that would contain 4 elements (Figure 1): (1) a safe vector that could reach the heart by systemic injection and show stable expression of the gene in the heart (2) a therapeutic gene for cardioprotection against ischemia (3) a tissue-specific promoter to drive the transgene to express mRNA in the heart only and (4) a gene switch that would switch on the tissue-specific promoter in response to hypoxia and that would switch off in response to normoxia.

    Figure 1. General design for a “vigilant vector” that could be applied for constant protection against cardiac ischemia, diabetes type 1, stroke, heart attack, cancer, or even bioterrorism. The main elements are (1) a safe, stable vector (2) a gene switch (3) a tissue-specific promoter and (4) therapeutic genes (with a reporter gene to monitor its activity).

    For the vector, the adeno-associated virus (AAV) is proving to be a stable, nonpathological vector. 2,3 There are several genes that could be considered for protection of the heart during ischemia. In a previous study 4 we had found that the angiotensin II type 1 receptor (AT1-R) antisense (AS) protected rat hearts from ischemia-reperfusion. Dzau et al 5 have recently shown that transgenic mice with hemoxygenase are protected from cardiac ischemia. Superoxide dismutase protects against super oxide radicals generated during ischemia or reperfusion. 6 Thus, these genes are good choices for cardioprotective transgenes in the vector. For tissue-specific expression of AAV in the heart, we have studied the ventricular form of myosin light chain (MLC-2v). 7,8 MLC-2v expression is important in the development of the heart during embryogenesis, and alterations in the MLC-2v expression produce cardiac defects. 8 In humans, cardiomyopathy is associated with point mutations in MLC-2v. 9 MLC-2v seems to be highly specific for hearts, both during embryonic development and in post-natal development and maturity. The MLC-2v promoter is 3.0 kb, but the sequences that give it the property of heart specificity are within 250 bp, close to the TATA box. 8,9–13 We tested the specificity of a 1700 kb and a 281 bp MLC-2v promoter in AAV delivered in vitro and in vivo. To switch on the vector, we tested a hypoxia-regulatory element (HRE) which is activated by transactivating hypoxia inducible factor (HIF-1) in response to a reduction in oxygen. 14,15 Under normoxic conditions, the HIF-1α subunit is undetectable because it is degraded by proteosomes, 16,17 but during hypoxia HIF-1α is no longer degraded it accumulates exponentially as cellular hypoxia increases. 18 Although we have not completed and tested all components of a vigilant vector, we present the results of a study on the heart specificity of MLC-2v and its interaction with HRE and HIF-1α.

    Methods

    Construction of Plasmid and Recombinant AAV

    The linear, single-stranded AAV-derived vector can be adapted for several genes and promoters between the inverted terminal repeats (ITRs) at each end (Figure 1). We inserted a reporter gene, green fluorescent protein (GFP), and a rat 1.7 kb MLC-2v promoter (pMLC-2v-GFP). Methods to prepare recombinant AAV (rAAV) have been described previously. 19 The pMLC-2v-GFP was packaged into AAV-2 (rAAV-MLC-2v-GFP).

    A 281 bp (−264 to +17, Genebank: U26708) fragment of MLC-2v promoter was amplified by a polymerase chain reaction (PCR) from pMLC-2v-GFP with the primer pair designed with 5′ XhoI or 3′ HindIII sites on the ends. The MLC-2v fragment was digested by XhoI and HindIII and ligated to XhoI/HindIII-digested plasmid gene luciferase (pGL)-SV40 (Promega) to generate pGL-MLC.

    Based on Semenza et al, 14 a 68bp human enolase (ENO) 1 HRE sequence (-416 to -349, Genebank: X16287) was inserted into 5′ flank of the MLC-2v promoter in the pGL-MLC to generate pGL-HRE/MLC.

    pCEP4/HIF-1α, which contains human HIF-1α cDNA sequence downstream of a cytomegalovirus promoter, was a kind gift from Dr Semenza (Johns Hopkins University).

    In Vitro Transfection

    Rat embryonic cardiac myoblast cell line, 20 H9c2 (ATCC: CRL1446), or glioma cells C6 (ATCC: CCL-107) were grown in DMEM supplemented with sodium pyruvate, 10% fetal bovine serum (FBS), or 5% FBS in an incubator (Quene Systems, Inc) with a humidified atmosphere of 5% CO2 and 95% air at 37°C. Hypoxia conditions were achieved using hypoxia chambers (Oxygen Sensors) by evacuation and gassing with 1% O2/5% CO2/94% N2 repeatedly, tightly sealing the chambers, and then incubating them at 37°C.

    To examine the MLC-2v promoter specificity in cells, both H9c2 and C6 cells were transfected with pGL-MLC (1 μg/well) cand internal control plasmid pRL-TK (50 ng/well, Promega) by using Lipofectamine (Invitrogen) in 6-well plates. Twenty-four hours after transfection, cell lysates were prepared. Luciferase assays were performed with the dual luciferase assay system (Promega) and quantified with a Monolight 3010 luminometer (Pharmingen). Results are expressed as a ratio of firefly luciferase activity over Renilla luciferase activity.

    For cotranfection experiments with pCEP4/HIF-1α, H9c2 was transfected with 2 μg/well pGL-HRE/MLC, 100 ng/well control plasmid pRL-TK, various amounts of pCEP4/HIF-1alpha, and empty vector so that all cells received a total of 6 μg plasmid in 60 mm dishes. Twenty-four hours after transfection, the medium was changed and duplicate plates were incubated at 1% or 20% O2 for 24 hours before preparation of lysates.

    Expression of AAV in Vivo

    All animals were kept in a temperature-controlled room on a 12-hour day/night cycle with free access to food and water. The Institutional Animal Care and Use Committee at the University of Florida approved all experimental procedures.

    AAV Expression in Adult Animal

    Adult male BALB/c mice (n=6) were obtained from Harlan (Indianapolis, Ind) and anesthetized with pentobarbital (80 mg/kg). 10 10 infectious particles of rAAV-MLC-2v-GFP (100 μL) were injected intravenously. After 2 to 8 weeks, animals were deeply anesthetized with pentobarbital (120 mg/kg). Samples of spleen, liver, lung, kidney, left ventricle, testis, and brain were dissected and frozen on dry ice.

    AAV Expression in Young Animal

    Five-day-old male Sprague Dawley rats (n=3) were obtained accompanied by their dam from Harlan. They were kept with their dam until 21 days of age. At 6 days of age, the pups were anesthetized with Metofane injected intracardiacally with 10 10 infectious particles of rAAV-MLC-2v-GFP (25 μL) or the same volume of saline as a control. Four weeks later, rats were deeply anesthetized with ketamine, xylazine, and acepromazine (30, 6, and 1 mg/kg, respectively, subcutaneously) and perfused with ice-cold saline via the left ventricle. Samples of spleen, liver, lung, kidney, left ventricle, testis, heart, and brain were dissected and frozen on dry ice for DNA, RNA, and GFP protein measurements.

    Detection of GFP

    Total RNA and DNA was isolated using TRIZOL reagent. Expression of green fluorescent protein (GFP) was analyzed by nested PCR. The GFP specific primers used in the first amplification were 5′-CAGCGGAGAGGGTGAAGGTG-3′(sense) and 5′-CAGGGCAGACTGGGTGGACA-3′ (antisense). The GFP specific primers used in the second amplification were 5′-GCCA- CATACGGAAAGCTCAC-3′ (sense) and 5′-ATGGTTGTCTG-G GAGGAGCA-3′(antisense).

    RT-PCR

    Twenty μg of total RNA were digested by DNase I in a 40 μL reaction mixture consisting of 40 U DNase I and 33 U RNase inhibitor. Reverse transcription (RT) and first amplification were performed in a single tube. Four μL of the RNA (2 μmg) pretreated with DNase I were added to 20 μml final volume of the PCR reaction. The first amplification was performed in the following conditions: 60 minutes at 37°C (RT) 4 minutes at 94°C 35 cycles of 1 minute at 94°C 1 minute at 58°C (annealing) 1 minute at 72°C and a final extension period of 7 minutes at 72°C in PE DNA Thermal Cycles 480. One μL product from the first amplification was added to 25 μL final volume of the PCR reaction. The conditions of second amplification were the same as the first with the exception of the addition of 30 cycles with annealing at 60°C.

    PCR

    One μg of DNA was amplified by nested PCR to detect GFP expression. The procedures were the same with GFP detection in RNA (RT-PCR) except DNase I digestion and Reverse transcription (RT) were omitted.

    Electrophoresis

    Amplification products were analyzed on 1% agarose stained with ethidium bromide. The expected product size was 489 bp.

    Immunofluorescence Staining

    Tissues were incubated in Zamboni’s solution overnight and cryosectioned at 20 μm thickness. The sections were blocked with blocking buffer (10 mmol/L TBS, 1.5% normal goat serum and 1% BSA) for 1 hour and incubated in primary antibody (0.1% anti-GFP, rabbit IgG) overnight at 4°C. After washing with TBS, the sections were incubated with 0.5% anti-rabbit IgG FITC in the dark at room temperature for 1 hour. The sections were washed and put on slides. The slides were covered by slips with fluoromount G when dry. GFP was detected within 3 hours by confocal microscopy.

    Results

    In Vitro

    The pGL-MLC was specifically expressed in cardiomyocytes. Figure 2 shows the luciferase activity of pGL-MLC-2v in cardiomyocytes (H9c2) and a lack of expression in a nonmyocardial cell line (C6). The relative luciferase activity ratio of H9c2 cells to C6 cells was 29.38±13.11. The uptake efficiency in both cell types was 90%.

    Figure 2. The expression of luciferase activity (relative to control) in cardiac (H9c2 cells) versus glioma (C6) cells after treatment with pGL-MLC. Myocardial cells specifically expressed the transgene. Cells were transfected with control pRL-TK (50 ng/well) and pGL-MLC (1 μg/well) plasmids. Duplicate plates were incubated at 20% O2 for 24 hours (mean±SD, n=3 independent experiments).

    In Vivo

    PCR of DNA showed the transduction of rAAV-MLC-2v-GFP in many tissues at 4 weeks after a systemic injection. The tissue-specific expression of GFP under MLC-2v promoter was examined by RT-PCR of RNA in the adult mouse tissues and young rats (Figure 3). GFP DNA was detected in the spleen, liver, lung, kidney, and heart. However, GFP mRNA was detected only in the heart.

    Figure 3. Top, Expression of GFP DNA in various tissues of the young rat detected by PCR. Bottom, Expression of GFP mRNA in the same tissues, detected by RT-PCR. Analysis was made of DNA and RNA extracted from the tissues 4 weeks after a single systemic injection of rAAV-MLC-2v-GFP.

    Four weeks after intracardiac injection of rAAV-MLC-2v-GFP, the presence of GFP in various tissues of rats was further examined by immunofluorescence staining (Figure 4). The green epifluorescence of the protein was clearly apparent in the heart and absent in the control (no GFP). GFP was undetectable in the kidney and liver of the same animals and undetectable in controls.

    Figure 4. Expression of rAAV-MLC-2v-GFP was present in the heart, but absent in the liver and kidney at 4 weeks after transduction in young rat. Control: rAAV without GFP. The immunofluorescence staining with an antibody to green fluorescent protein reveals intense expression in heart only, which matches the expression of mRNA from the same animal in Figure 3.

    Hypoxia did not induce an increase in transgene expression of the pGL-HRE/MLC (Figure 5). However, hypoxia induces a 3 to 4-fold increase in transgene expression when the HRE-MLC-2v enhancer/promoter complex is in the presence of 0.5 to 4 μg of HIF-1α in H9c2 cells (Figure 5).

    Figure 5. Hypoxia induces a 3- to 4-fold increase in transgene expression when the HRE/MLC enhancer/promoter complex is in the presence of rHIF-1alpha. H9c2 cells were cotransfected with 2 μg/well pGL-HRE/MLC (281 bp) and 100 ng/well pRL-TK, in the absence of rHIF-1α or in the presence of various amount of rHIF-1α plasmid, respectively. Twenty-four hours after transfection, duplicates were exposed to 1% or 20% O2 for another 24 hours. The ratio of firefly luciferase/Renilla luciferase activity was normalized to the result obtained for cells transfected with pGL-HRE/MLC (281 bp) and exposed to 20% O2 (X-Fold). Expression at 1% relative to 20% O2 was calculated to determine the hypoxia induction ratio. (mean±SD, n=3 independent experiments).

    Discussion

    The results demonstrate that the MLC-2v promoter incorporated into a rAAV vector can drive a reporter gene specifically in the heart. rAAV-MLC-2v-GFP was injected systemically, either through direct injection into the heart or via the jugular vein. Measurements of DNA showed that the vector was taken up into multiple tissues, including liver, lung, kidney, heart, and spleen. Although the rAAV-MLC-2v-GFP was taken up into many tissues after a single injection, the transgene (gfp) was only expressed in heart tissue. This was found in both mice and in rats. In two animals we found low-level expression in the liver but not in the kidney or other tissues. As AAV has limited loading capacity, we tested two truncated forms of MLC-2v. We used the 1700 bp length for the promoter in vivo and 250 bp in vitro to attempt to reduce basal levels without losing specificity. Both lengths contain the heart-specific cis regulatory elements 8 that endow the MLC-2v with its heart-specific responsiveness. 9,10 In glioma cells (C6) there was no expression of luciferase, although there was comparable uptake efficiency with or without the MLC-2v promoter.

    Attaching HRE to the MLC-2v with luciferase (Luc), as the transgene, did not alter basal expression in vitro at 20% O2. However, the HRE plus MLC-2v did not respond to 1% O2. With an HRE-SV40 promoter-Luc plasmid in heart cells, we have shown elsewhere that HRE will drive the promoter up to 7-fold under hypoxia within 4 to 6 hours. 21 We considered that the HRE/MLC-2v complex may have reduced the accessibility of the HIF-1α binding. To test this, we used an additional plasmid expressing the hypoxia inducible factor-1α (HIF-1α). 14–17 When we cotransfected a plasmid containing HIF-1α cDNA with pGL-HRE/MLC and exposed the cells to 1% oxygen we noted a 4-fold increase in Luc expression. Thus, the results indicate that MLC-2v can be used as a specific promoter for heart tissue, and HIF-1α plus HRE (but not HRE alone) will cause the MLC-2v to increase transgene expression in vitro by at least 4-fold in response to hypoxia. This is not a major limitation because dual vectors overcome the vector size limitation 22 and increase gene expression. 23 We are not yet satisfied that a 4-fold increase is sufficient to provide a cardioprotective effect with a therapeutic gene. A double plasmid approach that produces a powerful chimeric transcription factor consisting of the yeast transactivator factor GAL4 DNA binding domain and the p65 transactivation domain 24,25 is being tested. 21 Incorporating the HRE in this double plasmid system with SV40 promoter increased Luc gene expression by 400-fold when activated by hypoxia. 21

    The concept of a vigilant vector for cardioprotection can be applied generally to a number of other disease states. For example, in diabetes type 1, glucose would be the gene switch and insulin and its necessary enzymes would be the transgenes. The tissue specificity could be limited to the pancreas or to muscle. In cancer, tumor markers could be the gene switch, and the transgenes could be tumor suppressors. In heart attacks the switch would again be hypoxia or a protein marker and the transgene tPA. Similarly in stroke, hypoxia could be the switch and GFAP the tissue-specific promoter with hemoxygenase or superoxide dismutase or AT1-R-antisense as the therapeutic genes. For the vector, the rAAV seems to have the most desirable qualities of being safe and stable for a very long time. 2,3 Obviously each vigilant vector has to be designed and thoroughly tested, both in vivo and in vitro. Basal levels times of response, tissue specificity and amplification of signals are all challenges to be met. The present results represent promising new data for the development of a vigilant vector for long-term protection of cardiac performance during exposure to hypoxia.


    Tol2in frog

    Xenopus laevis has been a useful model animal in developmental biology. Recently, Xenopus tropicalis, a relative of X. laevis, is becoming an important model frog. It is amenable for use in genetic studies because of its unique features in comparison with X. laevis, specifically its diploid genome, smaller body size, and shorter generation time. Transgenic X. tropicalis have been constructed based on the restriction enzyme-mediated integration technique, which requires careful treatments of eggs and sperm [24].

    To develop an alternative and simpler method for creating transgenic X. tropicalis, the activity of the Tol2 transposon system was tested in Xenopus. First, both a Tol2 transposon-donor plasmid and the transposase mRNA were introduced into two-cell stage X. tropicalis and X. laevis embryos by microinjection. The transposon construct was excised from the donor plasmid, indicating that the Tol2 transoposon system is active in these Xenopus spp. [25]. Second, a donor plasmid that harbored a Tol2 construct containing the GFP expression cassette was co-injected with the transposase mRNA into one-cell stage X. tropicalis embryos, and GFP- positive F0 frogs (30% to 40% of the injected embryos) were raised to adulthood. GFP-positive F1 progeny were produced by 30% to 40% of such F0 adults, indicating that the Tol2 transposon system can be used for transgenesis in Xenopus (Figure 4) [26]. However, the germline transmission frequency is still lower than frequencies in zebrafish transgenesis, in which more than 50% of injected F0 fish constantly transmit transposon insertions to the F1 generation, even without pre-screening of the F0 injected fish for GFP positives. Therefore, in Xenopus improvement in transgenic frequency will be important in making the Tol2 transposon system a more powerful genetic tool.

    Transgenesis in Xenopus tropicalis. The synthetic transposase mRNA and a transposon donor plasmid containing a Tol2 construct with a ubiquitous promoter and the gene encoding green fluorescent protein (GFP) are co-injected into X. tropicalis fertilized eggs. The Tol2 construct is excised from the donor plasmid [25] and integrated into the genome. In the study conducted by Hamlet and coworkers [26], injected GFP-positive tadpoles were raised to adulthood. Tol2 insertions created in germ cells are transmitted to the F1 generation. Germ cells of the injected frogs are mosaic, and, by crossing theinjected frog (founder) with wild-type frog, nontransgenic tadpoles and transgenic tadpoles heterozygous for the Tol2 insertion are obtained [26].


    PTK-GLuc Vector

    The pTK-GLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive Herpes Simplex Virus thymidine kinase promoter. Gaussia Luciferase (GLuc) is a 20 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). pTK-GLuc has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation site. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418. Figure 1: pTK-GLuc multiple cloning site (MCS)
    The Gaussia Luciferase sequence is shown with a blue background. Only unique restriction sites are shown.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Highlights

    • TK promoter: 18&ndash771
    • GLuc coding: 802&ndash1359
    • Start codon: 802&ndash804
    • Stop codon: 1357&ndash1359
    • Signal peptide: 802&ndash852
    • Multiple cloning site (MCS) downstream of GLuc: 1360&ndash1391 (NotI, AgeI, XhoI, XbaI)
    • SV40 late polyadenylation signal: 1392&ndash1622
    • Neo promoter (SV40): 2215&ndash2550
    • Neomycin resistance gene 2602&ndash3396
    • Neo R poly-A(SV40 early): 3570&ndash3700
    • Bacterial replication ori (pMB1) 4730&ndash4142
    • Amp resistance 5761&ndash4901

    Product Source

    Features

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90&ndash95% of GLuc activity is found in the cell culture medium, with the remaining 5&ndash10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other cotransfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina Luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pTK-GLuc Vector can be transfected into cells using any standard transfection protocol and stable cell lines can be established using Neomycin (G418) selection.

    GLuc 3´ end Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (1310&ndash1325)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (829&ndash806)

    Application Features

    • The pTK-GLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion products Sold Separately).
    • pTK-GLuc Vector has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the GLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability, RNAi or miRNA target evaluation.
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina Luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Storage Buffer

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    1. Verhaegen, M. and Christopoulos, T.K. (2002). Anal. Chem . 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol. Ther. 11, 435–443.
    3. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
    4. Wu, et al. (2007). Biotechniques. 42, 290-292.

    This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB).

    While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications.

    For more information about commercial rights, please contact NEB's Global Business Development team at [email protected]

    This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

    New England Biolabs (NEB) is committed to practicing ethical science &ndash we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

    Licenses

    This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

    By opening this package or by using the materials enclosed within Recipient is legally bound and accepts the following terms and conditions:

    Non-Commercial Entities: This product is covered by U.S. Patent No. 6,232,107 and other patents that are the legal property as assigned to Prolume Ltd./Nanolight Technologies. This product is licensed only to the purchasing laboratory-research group. Recipient agrees not to transfer this plasmid or derivatives of this vector to any other laboratory, person or research group, even if within the same institution. Recipient agrees not to alter or make any changes to the nucleotide coding sequence or secretory coding sequence of the luciferase(s) contained within without prior written permission from Prolume Ltd./Nanolight Technologies (www.nanolight.com). Recipient agrees not to file for any patent rights or inventions claiming any portion of the Luciferase(s) within the material without prior written permission from Prolume Ltd./Nanolight Technologies.

    Commercial For-Profit Entities & Non-Profit Foundations (herein referred to as Commercial Recipients): Commercial Recipients wishing to derive products, engage in the sale or license of any products, discover drugs, or make inventions by use of the materials enclosed, fully agree to the terms mentioned above for Non-Commercial entities AND ADDITIONALLY agrees to and are hereby bound to use the materials FOR EVALUATION PURPOSES ONLY. Commercial Recipient hereby agrees to destroy and cease use of any materials or derivatives containing any portion of these materials within 180 days from receipt. Commercial Recipient agrees not to use the materials for any use, other than the 180-day suitability evaluation without prior written permission or obtaining a valid license from Prolume Ltd./Nanolight Technologies.

    Any Recipient that does not accept the license terms mentioned above, shall return the unopened package and materials to NEB for a full refund.

    Trademarks

    BIOLUX® is a registered trademark of New England Biolabs, Inc.
    QIAGEN® is a registered trademark of Qiagen.


    The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus

    A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

    Keywords: Promoter activity Recombinant baculovirus SbaP Shrimp beta-actin promoter The Pacific white shrimp.


    Luciferase promoter vector over p-AcGFP1-C1 vector - Biology

    Our promise to you:
    Guaranteed product quality, expert customer support.

    Reporter Stable Cell Lines

    As useful tools for scientific research, reporter stable cell lines are those cells involved in expression of reporter protein(s) which are engineered through integrating the reporter expression cassettes into cell genomes mediated by plasmid or lentivirus vectors. In the studies of life science and biotechnology, the commonly used reporter genes are visually identifiable including green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, secreted alkaline phosphatase (SEAP) etc.

    According to the upstream regulator of the reporter gene, reporter cell lines can be further divided into two groups: 1) Constitutive Reporter Cell Lines in which reporters are constitutively expressed under the control of a constitutive, strong promoter such as CMV promoter and 2) Inducible Reporter Cell Lines in which reporters are inducibly expressed under the control of a minimal promoter fused to multiple inducer response elements.

    Based on years of experience and in-depth investigation, scientists at Creative Biogene have established a large number of stable reporter cells in many popular cell lines suitable for multiple applications.

    Constitutive Reporter Cell Lines

    Inducible Reporter Cell Lines

    Table 1. Frequently Requested - Constitutive Reporter Cell Lines

    CategoryReporterHost Cell
    Fluorescent ReporterGFP143 B, 324, 4T1, 9L, A375, A498, A549, AGS, Anip 973, ASPC -1, B16F0, B16 F10, Boy, BT 474, BV2, Bx Pc3, Ca761, CAOV3, Capan-1, Capan-2, CHO-K1, CNE2Z, colo205, Colon 38, COS-7, CT-26, DAOY, DU145, EKVX, FaDu, FEMX I, Flo-1, H460, H69, HCC70, HCT-116, HCT-15, HCT-8, HEK293, HEK293T, HeLa, Hep2, Hep 3B, HEP-G2, HGC27, HOP-62, HT 1080, HT-29, HTB 9, Huh-7, JURKAT, K562, KM-12, KM 28 BM, KU-7, LL/2, LnCap, LOXMIVI, LS 174, Ls180, L-SLM, MCF7, MDA-MB-231, MDA-MB-435, MDA-MB-435 2C5, MDA-MB-435 4A4, MDA-MB-453, MDA-MB-468, MDCK, Mel526, MIA-Paca 2, MMT 060562, MOLM13, MSTO-211H, MV3, N87, NALM6, NCI-H1299, NCIH1437, NCI-H1975, NCI-H661, NCI-N87, NIH3T3, NUGC 4, OPM2, OST, OVCAR-3, OVCAR-8, PaCa28, Panc-1, Pan02, PC-3, PC-12, R40LN, RGMI#186, RPMI8226, SH-SY5Y, SK-BR-3, SK-Hep-1, SK-LU-1, Sk-mel-5, SK-OV-3, SL4, SN12C, SNB-19, SOSN2, SW1116, SW480, SW620, SCC-25, T24T, T47D, TOV21, U2OS, U87 MG, U937, UACC257, UM-UC-3, UM-UC 14, Vcap, WiDr, XPAI
    RFP143 B, 4T1, A375, A549, ASPC-1, B16F0, B16-F10, Bx Pc3, BV2, CEM, CHO-K1, CNE2Z, Colon 38, Colo26, CT26.WT, Dunning3327, DAOY, FEMX I, FaDu, FG A-12, H9C2(2-1), HCT-116, HCT-8, HEK293, HEK293T, Hep2, Hep 3B, Hep G2, HGC27, HMMG/HOS, HT 1080, HT29, Huh-7, KAK-1, LnCap, LOXMIVI, LL/2 H460, MDA-MB-231, MDA-MB-435 4A4, MDA-MB-435 2C5, MDA-MB-468, Mel526, MGC803, MIA-Paca 2, MMT 060562, MSTO-211H, MV3, MX-1, NCI-H1299, NCIH1568, NCIH1975, NIH3T3, NPA, NUGC 4, OVCAR-3, OVCAR-5, OVCAR-8, OST, Pan02, PC-3, R40LN, R90L, R90P, SK-BR-3, SW1116, SW480, SL4, SN12C, SOSN2, SH-SY5Y, SK-Hep-1, Sk-mel-5, T24T, T47D, TOV21, U14, U2OS, U87 MG, UM-UC 14, XPAI
    GFP + RFP143 B, B16 F10, DU145, H460, HCT-116, HT 1080, Lewis Lung, MDA-MB-435, MDA-MB-231, MIA-Paca 2, MMT 060562, MV3, PC3, U87 MG, XPAI
    Luciferase ReporterLuciferase4T1, A375, A549, B16F10, CT26.WT, HCT116, HT1080, LL/2, MCF-7, MDA-MB-231, SKOV-3
    Dual ReporterGFP + LuciferaseAGS, HCC70, HT-29, MCF7, NCI-H1299, NCI-H1975, NCI-H661, NCI-N87
    RFP + LuciferaseA549, CNE2Z, GBC-SD, H9C2(2-1), HCT-8, HEK293T, Hep3B, HepG2, HOS, Huh7, Li-7, MDA-MB-231, NCI-H1299, PLC/PRF/5, RBE, SK-HEP-1

    Table 2. Frequently Requested - Inducible Reporter Cell Lines