Information

12.10: Why It Matters- DNA Transcription and Translation - Biology

12.10: Why It Matters- DNA Transcription and Translation - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Why describe the conversion of DNA to RNA to proteins?

By now you’re familiar with genes and DNA sequences and how changes in the DNA can have a big impact. how? How does DNA cause anything to happen?

Our bodies contain trillions of cells that need to be constructed in very precise ways. Much like when a construction company creates blueprints before they actually begin a project, your body needs some kind of plan to accomplish this.

DNA is acts as a blueprint. With this plan in every cell, your body is able to convert DNA into action molecules, which are proteins, by way of an intermediary, RNA. This idea is so central to biology that it is often called the central dogma of biology: DNA is transcribed to RNA which is translated to protein. This multi-step process is one of the reasons for the diversity we see in the world around us.

Learning Outcomes

  • Outline the process of eukaryotic transcription
  • Summarize the process of translation
  • Outline the process of prokaryotic transcription and translation
  • Identify the central dogma of life

Darwin's God

Every biology student learns of two massive machines that operate on the DNA molecule. There is the transcription machine that makes a single-stranded copy of a gene, and there is the replication machine that makes a double-stranded copy of the DNA double helix. The former is the first step in the protein synthesis process while the latter is part of the cell division process. But what happens when these different machines meet as they operate on the same stretch of DNA? What are the rules of the DNA road?

New research suggests that the highly intricate replication process is not destabilized by head-on collisions wth the transcription machine, but merely pauses while it displaces the intruder. To do this it uses a protein that otherwise helps with transcription repair. As the paper explains:

It is research that is both important and interesting. And, as with any new finding, it may be relevant to the question of evolution. For instance, perhaps the theory of evolution had led us to predict this finding. Or, almost as good, perhaps the finding is reasonably inferred from the theory.

In this case a such a retrodiction would go something like this: If evolution is true then we would expect the replication machine to oust the transcription machine because random mutations could lead to such a design, but not to other conceivable designs.

But what if, on the other hand, evolution did not favor such a design? What if there was no such prediction, or retrodiction? Then it would be more difficult to enlist the design as support for evolution. In fact, what if evolution has no plausible explanation for the design?

In this case, perhaps the replication and transcription machines successfully negotiating their way in the crowded environment, resolving head-on collisions, and having an established “rules-of-the-road” is not likely given evolution’s random biological variation under the winnowing hand of natural selection. Here we would have a finding which does not fit evolutionary explanation, and the evidence shifts over from the plus column to the minus column.

What is interesting is how evolutionists routinely react to such findings. When presented with such designs, evolutionists almost invariably erect a series of fallacious roadblocks. You can see these same roadblocks used repeatedly, and they speak volumes about evolutionary thought.

One such fallacious roadblock is that placing such evidence in the minus column amounts to an argument from incredulity. “You can’t imagine how evolution could possibly have created such a design,” say evolutionists, “and so you think it is evidence against evolution.” It is a strange argument that places the burden on the one evaluating a theory also to defend the theory.

In fact anyone can “imagine” how evolution might have constructed the design, but what is needed is a plausible explanation. Evolutionists want us simply to accept an empty narrative. The problem is not incredulity on the part of the evaluator but credulity on the part of the evolutionist. “Don’t worry, it evolved” is not a plausible explanation.

This fallacious complaint of evolutionists also is another sign of the protectionism that runs through evolutionary thought. If findings that a theory does not explain are not allowed in the minus column, then what could possibly harm the theory? It is the ultimate form of unfalsifiability. Evidences that the theory explains make it a fact and DNA rules-of-the-road don’t count because that would be an argument from incredulity.

81 comments:

That argument from incredulity card is badly frayed at the edges. But the difficult part is that all their cards are badly frayed at the edges. Nifty way to keep you guessing, huh.

What is also interesting to say the least is their insistence that their 'mountains' of evidence for evolution does not amount to an argument from incredulity.

Judge: "Well sir, what hard evidence do you have to prove evolution is true?"

Coyne: "Well, first of all your honor, science doesn't seek to 'prove' anything but to find the best explanation based on the evidence. Science is always open to correction. Anyway, we have lots of pieces of information that allows us to make a reasonable inference as to what happened."

Judge: "Translation, you don't have any hard evidence but lots and lots of circumstantial evidence".

Coyne: "Well, I wouldn't quite put it that way, but in essence ye."

Judge: "Very well. [turns to the Meyer]. And you sir, what direct evidence do you have to prove your position that life is designed and cannot be explained in natural terms only as Mr. Coyne contents?"

Meyer: 'Well, first of all your honor, science doesn't seek to 'prove' anything but to find the best explanation based on the evidence. Science is always open to correction. Anyway, I too have lots of evidence that allows us to make a reasonable inference (i believe the best inference)that life is designed.

Judge: "Translation, you don't have any hard evidence either but lots and lots of circumstantial evidence, right?".

Meyer: "Yes, er that right, your honor. I wish to constrast my inference to best explanation against Mr. Coyne's inference to best explanation, since neither of us have any direct evidence.

Judge: "Alight, here are the ground rules. Points for logical, well reasoned arguments, and demerits for any just-so-stories. At the end of the day, I will tally them up and the one with the most points wins the case.

Steve: "Judge: "Alight, here are the ground rules. Points for logical, well reasoned arguments, and demerits for any just-so-stories. At the end of the day, I will tally them up and the one with the most points wins the case."

Yep, that's exactly what happened in Kitzmiller vs. Dover. The IDCer had every chance to make their case in front of the world, and they did a complete face plant. Dembski chickened out and made a lame excuse for not testifying. Behe did testify and made himself look like a total fool over his lack of knowledge about current scientific research. The rest of the IDCers did their best impersonation of clowns piling out of their teeny circus car. Had it been a football match, the final score was something like 137-0, IDC lost. "Breathtaking inanity" indeed.

Ever since then IDC has pretty much fallen off the radar. There are a few isolated web sites like Uncommonly Dense and this one, populated by a remaining handful of woefully scientifically ignorant true believers. Kinda like the few poor Japanese soldiers on isolated desert islands who fought on for years after 1945, not knowing WW2 had ended.

Oh well, it's still good entertainment watching them figure out new and different ways to embarrass themselves.

"In fact anyone can “imagine” how evolution might have constructed the design, but what is needed is a plausible explanation."

Well, here's a working hypothesis:

Head-to-head collisions are disastrous without machinery to resolve them. However, it is clear from other studies head-to-tail collisions cause no stalling of the replication fork.

So I hypothesize primitive genomes were organized with origins and promoters in the same orientation. Interestingly, modern bacterial genomes have 80-98% of their rRNA genes, and significantly greater than 50% of their genes co-oriented with the origin of replication. Some viruses (and I think mitochondria) have entirely the same orientation.

Later, MFD1 evolves-it has similarity to helicases, and works to help RNA polymerase detach in a number of broken DNA contexts. It also works on head to head collisions.

This allows a more dynamic genome, recombination without respecting orientation. beneficial. Bacteria start to put genes on either strand, with more complex regulation.

Now, as a test, I could synthesize test genomes with and without co-orientation, and query the essentially of such a protein in each.

I could also do detailed phylogeny on Mfd-how ancient is it, what is it most related to. Do any organisms lack it, and how do they deal with collisions?

I could even invert some rRNA genes in E. coli, test for ill effect, and see if Mfd overexpression works to compensate.

I'm sure there is much more to tidy up such a story, but it isn't my field, and it is late. Nevertheless, I hope this shows how a plausible hypothesis can be established and tested. You could have thought of something (probably better) but chose not to. That is what design suggests you do-stop thinking about how-stop inquiring. Why ask how, when that is already answered?

"Evolutionists want us simply to accept an empty narrative"

Nope, we want to do detailed empirical research, and not have you represent evolutionary biology as a field empty of process and progress, that throws its hands up in the air when it sees 'complexity.'

"Ever since then IDC has pretty much fallen off the radar. "

You should be a comedian.
Your logic and your pseudo science are very humorous indeed.

Amazing how Darwinists cannot see that they are the ones that can't figure out what probabilities mean and why it matters in biology.

You brain dead Darwinian fundamentalists should call your weak and ignoramus reasonings "The Worrell Family Science Emporium".

Rob said, ". I'm sure there is much more to tidy up such a story"

Here we go again, yet another story passing for a plausible mechanism.

You never learn that science is not story telling and that conjecture and speculation are not facts.

You're very fond of parroting these supposed 'probabilities.' Care to give us an example and apply some mathematics to this system?

Thorton, so what's your answer to the article? I think you know that the Dover case was basically meaningless since the Judge copied vast portions of the ACLU script verbatim in his ruling. ID certainly does have the best explanation for the evidence. Evolutionists are forced to rely on countless miracles to save their theory. We all know that meaningful or specified information does not simply emerge from a magic hat. Complex body plans do not emerge in a geological blink of an eye.(Cambrian Explosion) Relying on the multiverse just so story cannot rescue stellar evolutionary ideas. Exquisitely designed machines do not simply pop into being by chance. Protectionism wouldn't be necessary if there really was good evidence to silence the opposition. If it weren't for your worldview that has blinded you to the truth, you might have great insight. Better get used to ID ideas. It's only going to get worse from here on out. If it is good entertainment for you, then you are in luck, but one of these days, I have a feeling it will stop being so funny and become a serious matter. Already many people wonder if it isn't the evolutionists who are embarrassing themselves because of their staunch seemingly immovable faith in Father Charlie.

"Specified information does not simply emerge from a magic hat"

How much specified information does Mfd contain? How many units of specified information is it from its nearest relative?

LOL! I just love the IDC mouthbreathers who come out of the woodwork to spout the same old empty boasts. "ID is taking over science!! Evolution is on its deathbed!! Oh God it's SO complex, it just HAS TO be designed!!"

When you guys stop beating your gums and produce some actual positive evidence through your research, maybe mainstream science will stop laughing.

Here's the sum total of ID 'theory' to date:

"An unknown Designer at an unknown place and unknown time using unknown materials with an unknown process and for unknown reasons manufactured something".

Feel free to provide more details, anytime.

Here's the big thing you IDCers still haven't figured out:

Just because science hasn't discovered all the details of everything that has gone on in evolutionary processes in the last 3.3 billion years doesn't mean that ID wins by default.

Science is perfectly OK with saying "I don't know, so I'll research it more" for areas like abiogenesis or the origin of DNA replication. IDCers think that "I don't know yet" equates to "MY Intelligent Designer must have done it!!" It's the same stupid false dichotomy that ID has been living on for years. IDers like to pretend there are only two categories

1) Natural processes did it
2) ID did it.

In reality there are three categories

1) Natural processes we currently understand did it.
2) Natural processes we currently don't understand did it
3) ID did it.

Just because some data isn't in category 1) doesn't mean it automatically falls into 3) That's why science require positive evidence for a position, not just "ToE can't explain this so ID wins. And positive evidence for ID is something you have ZERO of.

“You could have thought of something (probably better)”

Rather than “primitive genomes were organized with origins and promoters in the same orientation” I would have them randomly oriented from the beginning, thereby avoiding any suggestion of teleology or design, and keeping with the evolutionary theme of randomness. Next I would have the consequence of head-on encounters be that transcription fails. This, it could be argued, was only mildly serendipitous, if we avoid the (probably more likely) consequence that both fail, and present it as a 50/50 case. With replication persisting you (i) avoid the fatal problem of reproduction not working and (ii) have a nice segue to the extant design.

And with transcription failing you simply have more useless DNA. How did functioning gene sequences arise in the first place? Who knows, but surely there were plenty of useless segments. So what if you have some more useless segments as a consequence of head-on encounters. Also, one could argue that in such primitive forms these head-on encounters were not so frequent because … transcription was not as common, or replication was not as common, or both, or … whatever.

Later MFD1 evolved because it helped RNA polymerase do its job. But its function was somewhat flexible, or sloppy, such that it could actually perform multiple tasks sometimes. These were refined, and thus you had a divergence of functionality, as multiple, well developed, functions arose. In the case of the head-on encounter functionality, MFD1 helped to oust RNA polymerase in a more orderly fashion, thus enhancing the probability of a successful restart. This opened up about half the genome to successful transcription, which by the way was becoming increasingly important as transcription and replication frequencies were probably increasing significantly.

Of course much of the newly transcribed genome was junk, but there could have been some useful sequences. And in any case this would have increased the selection pressure on that half.

There you have it, evolution happens.

Unfortunately this scenario, or yours if you like, is not a plausible explanation. There is substantial detail missing which shows no sign of being easy (which is why it is missing). What is even more unfortunate is that evolutionists seem to be oblivious to this problem. Aside from making occasional charges of “just-so stories” against sub hypotheses they don’t favor, evolutionists routinely construct their own just-so stories. But it is easy to be oblivious to such problems when the overarching idea is a fact. The problem of explaining designs, such as the DNA rules of the road, is not to justify evolution’s plausibility, but rather to elucidate a process that, one way or another, must have occurred. It is question of *how* it worked, not *whether* it worked, and the bar is lowered ever so low. For evolutionists, what passes as “plausible” is amazing.

"One such fallacious roadblock is that placing such evidence in the minus column amounts to an argument from incredulity. “You can’t imagine how evolution could possibly have created such a design,” say evolutionists, “and so you think it is evidence against evolution.” It is a strange argument that places the burden on the one evaluating a theory also to defend the theory."

It is a passing strange (ahem!) argument, isn't it? And, at the same time, it exposes the curious credulity of Darwinists, does it not?

"But what happens when these different machines meet as they operate on the same stretch of DNA? What are the rules of the DNA road?

New research suggests that the highly intricate replication process is not destabilized by head-on collisions wth the transcription machine, but merely pauses while it displaces the intruder."

I don't know whether my understanding of this is correct, as I'm not a biologist.

I am, however, a computer developer, and what is described here, sounds pretty much like thread management.

Suppose you have two users accessing the same variable. The two users run code in different threads, but the two threads use the same variable. How do you prevent all kinds of weird anomalies when different threads want to change the same variable? You add a lock on the code section: This means that when the first thread enters the lock, it has exclusive rights to execute it. The second thread needs to wait for the first thread to exit the lock, before the second thread can continue.

It is absolutely remarkable how simmilar DNA is to computer programming. Not just in the simplistic, such as syntax, but also in the more advanced areas.

I would not be surprised if we were to discover Object Orientated programming in DNA, where logic is encapsulated in functions, which gets called from other areas of the DNA, rather than to have the same logic duplicated where ever it is needed.

Oh, and I would dare any Darwinists to show me a natural process capable of producing computer code. I think Darwinism is intellectually bankrupt, and its entire foundation is baseless assertions.

Hanno ,
you may get "hurricane" answer like I did few days ago when asked similar question.

Hanno: "Oh, and I would dare any Darwinists to show me a natural process capable of producing computer code. I think Darwinism is intellectually bankrupt, and its entire foundation is baseless assertions. "

LOL! another computer science guy who doesn't understand the difference between analogies and reality. Too funny.

When scientists speak of DNA 'code', they are using a broad definition of code as 'any process that maps a specific input to a specific output'. Computer code falls under a different definition of 'code': 'a system of using abstract symbols to pass a message over a medium.' IDCers love to equivocate over the two definitions.

Computer code is used as an analogy for DNA function, but like all analogies it breaks down when examined closely. In the fundamental mechanics the two operate completely differently. Computer code uses abstract symbols to pass information to the machine doing the work. The symbols are independent of the medium and needs to be interpreted at a different time in order to perform operations. DNA on the other hand is not abstract at all. It is a physical molecule that is part of a self- sustaining chemical reaction (granted an amazingly complicated one). A reaction that merely follows the laws of chemistry and physics to proceed. It is completely dependent on its physical structure. A model of DNA created out of sticks and clay and won't code for a protein no matter how hard you pray.

I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does.

Try the other way around :
computer processor just moves electrons around because some other electrons were presented to processor electron storage matrix so it forces them against each other.Of forced bunches of electrons some squeeze others and emerge into some other paterns of electrons blah blah
Electron bunches just move acording to natural laws

This reply from the evolutionist speaks volumes.

====
LOL! another computer science guy who doesn't understand the difference between analogies and reality. Too funny.

When scientists speak of DNA 'code', they are using a broad definition of code as 'any process that maps a specific input to a specific output'. Computer code falls under a different definition of 'code': 'a system of using abstract symbols to pass a message over a medium.' IDCers love to equivocate over the two definitions.

Computer code is used as an analogy for DNA function, but like all analogies it breaks down when examined closely. In the fundamental mechanics the two operate completely differently. Computer code uses abstract symbols to pass information to the machine doing the work. The symbols are independent of the medium and needs to be interpreted at a different time in order to perform operations. DNA on the other hand is not abstract at all. It is a physical molecule that is part of a self- sustaining chemical reaction (granted an amazingly complicated one). A reaction that merely follows the laws of chemistry and physics to proceed. It is completely dependent on its physical structure. A model of DNA created out of sticks and clay and won't code for a protein no matter how hard you pray.
====

This is what evolution is about. Having just enough knowledge to be dangerous, mandating their theory must be a fact because their religion demands it, injecting their religion into their science, accusing others of doing just that when they never did any such thing, ignoring massive problems, ridiculing the question, and when they do give an answer it fails to address the problem. In this case it simply raises yet more profound problems.

Indeed, a profound difference between biology and engineering is that in biology the feedback loops, signals, information, and so forth, are very much part of the plant. This makes it profoundly more complex, something evolutionists seem to take for granted without having a clue about.

Religious certainty based on ignorance, coupled with hypocrisy and demonization. It sounds like incredible hyperbole, but all one need do is read the literature (or the comments).

"Rather than “primitive genomes were organized with origins and promoters in the same orientation” I would have them randomly oriented from the beginning, thereby avoiding any suggestion of teleology or design, and keeping with the evolutionary theme of randomness."

Summarizes why ID (as a science) is doomed-it started with a pre-falsified premise:

Anything non-random is teleological!

The genetic variation going in to evolution is the product of random processes, but selection produces anything but random results. Take my hypothetical example-if ancient replicators ligated genes together in the wrong direction, they are doomed. So a simple selective process can produce a result where all gene promoters are ordered in the same direction. We see the remnants of this system today. This organization LOOKS designed to Cornelius, and he immediately screams designer, but is just the product of necessity.

Moving to less hypothetical examples, we know in directed evolution, genetic algorithms, and direct observations that information can increase in evolution.

Until you soundly refute this point, you have interesting but irrelevant observations.

And arguing that evolutionary biology hasn't solved every detail of every last system doesn't argue for ID as a replacement. It is a testament to its success that you have to keep moving to smaller and smaller systems, and more recent discoveries to find what science doesn't know yet/

I provide a pathway to study the evolution of this system above. What ID-based path would you take to understanding? Oh, right, there is non, because you presume the answer at the onset. Even your silly counter-example presumes evolution.

"Religious certainty based on ignorance, coupled with hypocrisy and demonization. It sounds like incredible hyperbole, but all one need do is read the literature (or the comments)."

Oh, and just for fun, some gain-of-function from selection acting on random input. Yeah, the empirical falsification of ID:

Btw, these are natural gain-of-function mutations:

Ok, so those are all natural, but here's a cool directed evolution type experiment-random domain shuffling yields new interesting phenotypes following selection:

Rapid diversification of cell signaling phenotypes by modular domain recombination.
Peisajovich SG, Garbarino Science. 2010 Apr 16328(5976):368-72.JE, Wei P, Lim WA.

If you are interested, google 'directed evolution' for a ton more along these lines-where human made random variation + selction -> new function.

"Information" from randomness if you will.

". what is needed is a plausible explanation." No, what is needed is the scientific method applied to the theory of evolution. A scientific method consists of the collection of data through observation and experimentation, and the formulation and testing of hypotheses. "Plausible explanation" is not science unless backed by a scientific method. By accepting a "plausible explanation" you set the bar so low that evolution becomes believable.

Cornelius: "This is what evolution is about. Having just enough knowledge to be dangerous, mandating their theory must be a fact because their religion demands it, injecting their religion into their science, accusing others of doing just that when they never did any such thing, ignoring massive problems, ridiculing the question, and when they do give an answer it fails to address the problem. In this case it simply raises yet more profound problems.

Indeed, a profound difference between biology and engineering is that in biology the feedback loops, signals, information, and so forth, are very much part of the plant. This makes it profoundly more complex, something evolutionists seem to take for granted without having a clue about.

Religious certainty based on ignorance, coupled with hypocrisy and demonization. It sounds like incredible hyperbole, but all one need do is read the literature (or the comments)."

LOL! CH, I notice you trotted out the same tired old creationist canards we've all heard for years but didn't address a single point I raised in any of my posts.

Just another epic FAIL for the science-free IDCers.

One such fallacious roadblock is that placing such evidence in the minus column amounts to an argument from incredulity. “You can’t imagine how evolution could possibly have created such a design,” say evolutionists, “and so you think it is evidence against evolution.”

And yet the same evolutionist who uses this argument then proceeds to tell us that evolution must be true because God wouldn't have created things the way they are. So they can use the argument of incredulity against the existence of a creator but we can't use the same argument against the viability of evolution?

Me thinks I smell a double standard here.

I've read some of the replies to my comments. It appears that to Darwinists, Evolution IS the scientific method. When observations is made in other sciences that contradict some aspect of Darwinian theory, Darwinists are quick to dismiss it as "Oh, but because its not biology, it does not count." Evolution sits on its own little island, untouchable by other sciences.

Also, Darwinists seems to have difficulty understanding simple arguments. So, I am to understand that DNA is not like computer code, because, physically, they are quite different? So what? I already know that! No one is making an argument that they are physically identical. When we say DNA is like computer code, we are refering to their INFORMATIONAL properties. And the INFORMATIONAL PROPERTIES are identical, as far as structure, as well as being a NON-PHYSICAL, ABSTRACT ATTRIBUTE. Chemistry CAN NOT EXPLAIN the Information needed to produce a self replicating cycle because physically, there is nothing ordered in information, it is completely irregular. Information is significant, because it is irregular and it is specified, a highly unlikely combination. The problem with Darwinists is that they are ignorant: They study Darwinism only and know nothing of what other scientific fields have to say about it.

And then there is the argument that I, as a lay man, could not possible know enough to understand the complexities of Darwinian theory. Well guess what, Darwin's theory is as simple as it is stupid. And I WILL question "scientists" who blurt out just-so stories as valid scientific theories, who are unable to accurately portray ID before "refuting" is, and who set themselfs up as "THE HEROIC DEFENDERS OF SCIENCE", while having a blind eye for the fraudulent proofs that is presented to school children as evidence for Darwinism. such as Heacle's Embryo drawings. (This has been known for over a 100 years. ) Funny also how Darwinists insist that "theories should make predictions" and how every prediction Darwinism has made BEFORE THE FACT has turned out to be false: From the "simple protoplasm idea of the cell" in Darwins time, to Eugenics, to Junk DNA, to Evolutionary phycology that says self awareness is an illusion. You must have self awareness to have an illusion of anything, so how can selfawareness be an illusion itself? So, being alive is just an illusion, where really just as dead as my laptop. I know of no other scientific fields where scienitists are so often "surprised" by new discoveries as in Darwinism. Maybe that says something about your paradigm!

ID has made a strong case, using empirical evidence, and combining various scientific dissiplines, while Darwinists only reinforce their case by destroying their own reputations with pathetic "refutations". You have a better chance to see a blind man hit a bulls eye, than to see a Darwinist making a case against what ID ACTUALLY states, rather than against their own imagination.

"And yet the same evolutionist who uses this argument then proceeds to tell us that evolution must be true because God wouldn't have created things the way they are. So they can use the argument of incredulity against the existence of a creator but we can't use the same argument against the viability of evolution?

Me thinks I smell a double standard here."

When we say there is no natural process in the known universe that can produce specified irregularity, apart from ID, they say it's an argument from ignorance. But they themselves have no problem with using vestigial structures as evidence for evolution. Yet, just because we don't know why something is constructed a certain way, does not necessarily mean that it is evolutionary junk. Remember junk DNA? Arguments from ignorance are used all the time to defend evolution.

Then there is the claim that Irreducible Complexity is unfalsifiable. I will grant the Darwinists this one, it is a bit fuzzy, and it is easy to circumvent with the creative imagination of Darwinists. But Darwin wrote Evolution can be falsified by showing that structures exists which could not possibly be formed in a slow and gradual process, in other words, that IC exists. If IC is unfalsifiable, then so is Darwinism, because IC is the criteria with which to falsify Darwinism.

"Computer code is used as an analogy for DNA function, but like all analogies it breaks down when examined closely. In the fundamental mechanics the two operate completely differently. Computer code uses abstract symbols to pass information to the machine doing the work. The symbols are independent of the medium and needs to be interpreted at a different time in order to perform operations. DNA on the other hand is not abstract at all. It is a physical molecule that is part of a self- sustaining chemical reaction (granted an amazingly complicated one). A reaction that merely follows the laws of chemistry and physics to proceed. It is completely dependent on its physical structure. A model of DNA created out of sticks and clay and won't code for a protein no matter how hard you pray.

I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid. In fact, the code does differ in some species.

Also, the DNA specifications get translated into an amino acid string that just happen to fold into a workable protein. There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question. Yes, chemistry dictate what DNA looks like, and chemistry control the translation of DNA, but it DOES NOT explain why DNA the translated molecule from DNA should have any meaningful function at all. In fact, without this information, you can not even build the molecules that does the translation, as they themselves are incoded into the DNA.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

"I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The fact that the genetic code is *not* universal, the fact that there is no chemical necessity that *this* codon triplet translate to *that* amino acid shows that the DNA medium is not the message.

But, of course, one knows better than to ever expect the DarwinDefenders to admit to such a truth.

There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question.

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic
Code

I am particularly struck by the difficulty of getting [the genetic code] started unless there is some basis in the specificity of interaction between nucleic acids and amino acids or polypeptide to build upon. (Woese 1967)

Nonetheless, it is clear that at some early stage in the evolution of life the direct association of amino acids with polynucleotides, which was later to evolve into the genetic code, must have begun. (Orgel 1968)

Part I: The Observed Mechanism of RNA–Amino Acid
Interaction

Just above, Carl Woese and Leslie Orgel, writing at the dawn of molecular biology and coding, suppose that chemical interactions between nucleotide sequences and amino acids are an indispensable basis for the genetic code. It is the conclusion of the present narrative that such interactions are easily demonstrated, utilize plausible, simple chemistry, and can indeed be shown to echo part of the genetic code.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

Abstraction is a mental activity. Don’t confuse pattern recognition by the human mind for the operation of stereochemical processes :: Don’t confuse the map with the territory.

Hanno: "The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid."

LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

The human description of the reaction uses abstract symbols, but not the reaction itself. HUGE difference.

Here's an experiment you can do Hanno. Trot on down to your local ID lab. Build a replica tRNA molecule from Tinkertoys. See how long it takes that molecule to create a Tinkertoy amino acid. Get back to us with the results.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water
.
SO3 + H2O --> H2SO4
.
is abstract.
"

These people are fools it's not that they're ignorant, it's not that they're stupid, it's that they are intellectually dishonest. It's that they intentionally assert falsehoods and intentionally engage in faulty reasoning . all in a hopeless effort to protect Darwinism (and atheism) from rational scrutiny.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

You are either ignorant of how DNA translate into amino acid strings, or you are dishonest.

There is no chemical reason why one DNA base pair should be followed by another particular base pair. In fact, if there were, DNA would've been a crystal, unable to carry any information. Its message would be reduced to something like ATGCATGCATGCATGC.

The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code. Seen from a purely physical perspective, the base pairs are irregular and chaotic. It is the abstract meaning of the code that makes it significant. Information is recognized when there's specification, without any physical attachment with the object being specified. Nature does not create specifications, it simply follows laws of physics wherever they lead. Specification is always a product of mind.

No one is arguing the physical mechanism to read and interpret the data. Computers read their data via physical processes as well. Without it, the data would be meaningless. No one is disputing the physical processes involved in reading the data. That is not the issue, the issue is the data itself.

"You are either ignorant of how DNA translate into amino acid strings, or you are dishonest."

A DarwinDefender will do or say just about anything, including emulating a stultifying and irreversible ignorance, in order to keep from seeing that not only is his evolutionism false, but that it can't even be true.

Hanno: "The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code."

That's just plain stupid. Maybe you should go look up the definition of 'abstract' and 'abstract symbol' before you stick that other foot in your mouth.

BTW, how's that experiment with the Tinkertoys coming? Have the 'abstract' toy molecules produced any amino acids yet?

Specification is always a product of mind.

There is no chemical reason why one DNA base pair should be followed by another particular base pair.

Did you read the reference I gave you?

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic Code

There's plenty of reason, apparently.

Hanno: "Specification is always a product of mind."

Translation: "Make me admit the self-evident truth that I *will not* admit."

That's OK, he can still prove it. Or you might try.

abstract or an abstraction?

If the former, did a "mind" design it?

"In the 1880s, Rydberg worked on a formula describing the relation between the wavelengths in spectral lines of alkali metals"

Ofcause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

The formula itself has no physical relationship with the thing it describes, and yet it specifies it.

Also, isn't always Darwinists who complain that you "can't proof a negative?". Specification IS ALWAYS the product of mind, and we know this from everyday experience. If you feel that undirected natural processes are capable of producing specification, then the burden of proof is on you.

Lastly, I admin I have not read your article. I have very limited time, and I'm growing quite weary of Darwinists who constantly waste my time by referring me to articles that simply assumes evolution occurred, and then back it up with just so stories. I don't know what exactly that is suppose to prove. I do not refer you to Signature of the Cell. Though it would be great if you could read it yourself, I know you are probably to biased to bother, so I describe the argument as best I can in a post short enough for you to read.

Rather than bombarding me with links (Which I noticed is a favorite tactic of Darwinists) Why don't you just give me a summarized version of the argument, and if it isn't just another case of "We know evolution has occurred, so maybe this is how it could've happened", I'll read it. At least show me that you've read and understood the argument yourself, by explaining it in your own words, before referring me there. Otherwise, we might just as well stop talking to each other, and just start posting links.

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

As impressive as this all seems, I have only one question, one which David Berlinski has asked as well: "Can the results of Powner et al be reproduced without Powner et al?" - or in this case "Can the results of Yarus et al be reproduced without Yarus et al?"

All these abiogenesis experiments achieve is to underline how critical intelligent interference is in order to produce these molecules. Without an intelligent agent that filter out impurities, protect the molecule from degradation, and guide the molecule's development by playing the role of selection (selection for future advantage, I might add, which is basically what design is), all the abiogenesis scenario's fall apart.

Oh no? So what PHYSICAL property DOES dictate the sequence of DNA nucleotides? Enlighten me.

BTW, I don't exactly know what your point is with the tinker toys. No one ever argued that chemistry played no role in biochemistry. That would just be stupid.

Of cause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

Hanno, thanks for your comment, but you seem to be contradicting yourself. What mind designed the Rydberg formula? God's or Rydberg's? When ID persons use the word "design" referring to biology, it means "create." And then you say the formula does not describe the "actual" relation between the wavelengths, but it yet describes the relation between them. What is the function of the word "actual" in your sentence?

Who did the specifying in this specification? God or Rydberg?

By the same token, who specified the "actual" genetic code, chemical evolution, God, or human beings? Can you see that the code is a description conceived by humans of chemical processes that developed naturally, just as Rydberg's formula is a description of physical properties that matter displays?

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

Granted, the paper is technical, but since it refutes your reiterated claim that the genetic code has no chemical basis, you might at least have said something about it.

Surely the excerpt from the introduction that I posted earlier would have explained the issue well enough.

At some point, doesn't a science skeptic need to understand the science?

Regarding your first post, you seem to be making a category mistake.

The formula describing some feature in nature is distinct from nature itself. All formula's are derived from mind. E=mc2 is the formula and is a product of Einstein's mind. The atom bomb is physical effect. The formula IS NOT the natural effect, it DESCRIBES the natural effect. The particles themselves only react to chemical and nuclear forces, while the formula describes how they react. Formula's are forms of information, and like all information, it is the product of mind.

Likewise, there is no chemical necessity that DNA code should specify functioning proteins. You can mix the DNA code in any order you want, and, thanks to the machinery of the cell, is will produce a amino acid string, but that string will not necessarily fold into a stable protein. The SEQUENCE of DNA nucleotides constitute information, as it has no physical relation to the final product.

Secondly, regarding your paper, I will have to admit that you have me at a disadvantage. I did admit to being a layman in science, which means that I have SOME scientific knowledge, but not enough to comment on a highly technical paper. However, I do not think this disqualifies my position out of hand.

Firstly, there ARE ID scientists that DO understand these technical papers, and who are NOT convinced. (Scientists with all kinds of different religious backgrounds) According to them, all these papers assume evolution occurred, rather than concluding it. All abiogenesis experiments involve some form of human intervention, and always simulates conditions in a idealistic way rather than a realistic one. If abiogenesis is possible, one would expect a scientist to be able to set up the initial (realistic) conditions, and then sit back to see chemistry do its thing.

Secondly, ID Scientists make very strong arguments based on empirical evidence. One hardly ever see a calm reasoned response from Darwinists, rather it their replies involve name calling, and misrepresentations of the argument itself. If Darwinism is true, why can't they just answer the question, rather than avoiding it?

Thirdly, while Darwinists appear VERY concerned about the effect ID would have on science, one hardly ever hear any concern from them about inaccuracies on the Darwinian side. To the contrary, if you point them out, you're a "creationist".

Fourthly, there is a very clear double standard applied between ID and Darwinism. For Darwinism, just so stories are acceptable theories, while no amount of empirical evidence and reasoning seems to be enough for ID.

If ID made anything clear, it is that the Darwinian scientists are *NOT* honest in their motivations, and *DOES* exclude certain possibilities for purely philosophical reasons. Under these conditions, I feel perfectly comfortable attacking Darwinian theory.

Also, in Signature of the Cell, Stephen C Meyer outline his own study of the various theories on origin of live since Darwin to the RNA world. All these theories treat the origin of live as a purely chemical problem and either ignores or displaces the problem of informational origin. Though I can not do so myself, ID scientists like Meyer can understand your paper, and will criticize it. Moreover, I have a general idea of what his criticism would be: most probably displacing the origin of information out of view, rather than explaining it.

Now, I'm completely open to an explanation on how undirected natural processes can form information. I'm also not afraid of technical terms, as long as I can find an explanation for them. But to shoot above my head and then to call it quits is not fair play. Lacking knowledge is not the same as being stupid.


Introduction

The cell, with its variety of cellular compartments, varying polarities, competing interactions, and differing sites of molecular synthesis poses challenges to the formation of biomolecular interactions essential to all biological processes. This necessitates ways to bring biomolecules together in a tightly regulated manner. One mechanism for this localization is the use of molecular scaffolds to enable particular interactions while inhibiting off-pathway interactions, thus increasing the efficiencies of the biological processes in which they are involved in Zappulla and Cech (2006). Whereas proteins have long been appreciated to sometimes function as scaffolds, it is becoming increasingly clear that RNA molecules can also facilitate a wide range of interactions among and between proteins and nucleic acids, in many cellular contexts.

In this review, we define an “RNA scaffold” as an RNA molecule capable of bringing together 2 or more macromolecules to form a complex with functional activity. These macromolecules may be proteins, other RNAs or DNA molecules that in the absence of the RNA scaffold do not interact or do so very poorly. By this definition, perhaps the most well-known RNA scaffold molecules are ribosomal RNAs (rRNAs), which provide the structural and catalytic core of ribosomes around which approximately 57� ribosomal proteins (depending on species) (Lecompte et al., 2002) assemble to generate functioning ribosomes. Beyond this, long non-coding RNAs (lncRNAs) and even messenger RNAs (mRNAs) are now increasingly being shown to perform a diverse array of scaffolding roles. While rRNAs, bound by ribosomal proteins, are generally regarded as mostly static ribonucleoprotein complexes (RNPs) (Mathis et al., 2017)- although study of “specialized ribosomes” may shift this view (Genuth and Barna, 2018) – lncRNA and mRNAs are generally thought to facilitate more transient, regulatable interactions. Thus, RNAs can scaffold both stable cellular complexes and facilitate transient macromolecular interactions.

RNA can also function as a �oy” molecule, which we define similarly to a scaffold, except that in this case, two or more macromolecules are brought together by the RNA decoy in a complex that prevents the sequestered macromolecules from forming other interactions and functional complexes at other cellular locations. As with scaffolds, RNA decoy interactions can be transient and regulatable.

RNAs as molecular scaffolds or decoys possess several advantages over other types of biomolecules like proteins and DNA, including: (1) RNAs fold more readily than DNA into complex 3D structures by virtue of diverse secondary and tertiary structural interactions. (2) RNA abundance can be easily and rapidly increased (new transcription) or decreased (RNA decay) while using 1𠄲 orders of magnitude less energy than occurs for similar regulation of protein (Lynch and Marinov, 2015) indeed translation is the most energy-intensive process in a cell (Topisirovic and Sonenberg, 2011), whereas transcription (barring initiation) is largely an ATP-independent process (Imashimizu et al., 2014). (3) Unlike DNA, RNA is unencumbered with serving as a cell’s nuclear-localized permanent genetic material, thus increasing RNA’s regulatory potential. (4) Compared to proteins, RNA binds other molecules much more efficiently. For instance, 4� nts of RNA are capable of binding specific proteins, whereas protein-protein interaction domains typically range from tens to hundreds of amino acids (Prikryl et al., 2011 Chujo et al., 2016 Lunde et al., 2017). Additionally, RNA molecules are generally longer than most proteins (typical size of a globular protein = 5 nm radius of gyration of mRNA = 16.8�.8 nm) allowing greater spatial interaction potential with other biomolecules. (5) Evolution of RNA scaffolding functions likely occurs faster and is under less constraint than with protein scaffolds. This is evidenced by lower conservation of lncRNA genes versus protein coding genes (Johnsson et al., 2014), and the more complex protein folding rules and solubility issues that proteins face given their complement of 20 + distinct amino acids.

In this review, we discuss examples of many nuclear and cytoplasmic RNA scaffolds and decoys, some of which regulate relatively stable complexes, while others facilitate transient macromolecular interactions. Concepts of RNA-driven assemblies that have emerged, their physiological importance, and key remaining questions for future study will be highlighted. We will also focus on recent findings of mRNAs acting as cytoplasmic RNA scaffolds, and other means by which nascently translated proteins find their interaction partners. Finally, we discuss steps that can be taken to identify new RNA scaffolds and decoys.


Transcription/Translation Questions

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figure 1

A (the little circle): amino acid

B (the whole molecule): tRNA

C (this specific component of the molecule): anticodon

D (three at a time): complimentary codon to anticodon

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Proteins

Is the 5′ cap on the right or left hand side of the mRNA molecule above? left side

This is a diagram of what cellular process?
It is a diagram of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUGCCG 3’ , was built from the correct template strand of DNA, 3’ TACGGC 5’ . What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ ATGCCG 3’ , instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site?

In the A site, tRNA accepts amino acids passed from the P site. P site passes the amino acids to A sites.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

It would be TTA and it would be carrying N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5’_______3′.

7) If the template strand of DNA had the sequence 3′ ATGGGC 5′ , the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′ AUGGGC 3′ , UAC CCG
  2. 5′ AUGGGC 3′ , AUG GGC
  3. 5′ UACCCG 3′ , UAC CCG
  4. 5′ UACCCG 3′ , AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucine
  2. Glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

Multiple ribosomes traveling at one strand of mRNA is needed because the tRNA filters the ribosome randomly which makes the process untimely. The process is vital in order to make proteins in a timely manner because of the copy of mRNA.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

I think because mRNA is a copy.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figure 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap C
  2. Introns D
  3. Exons A
  4. poly-A tail B

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins?

Introns are the ones required and exons are the ones that are not needed during translation. One gene can code for multiple proteins by making different combinations every time.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’ TGCAATATT CGATGTCACCGCTCGAGAAC GACATCGATTAAC CATATTCG 3′ * 3’ ACGTTATAAGC|TAC|AGT|GGC|GAG|CTC|TTG|CTG|TAG|CTA|ATT|GGT|ATA|AGC 5’

mRNA: 5′ AUG UCA CUC GAG AAC GAC AUC GAU UAA 3′


Classwork and Homework 2/9

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figure 1

A (the little circle): Amino Acid

B (the whole molecule): tRNA

C (this specific component of the molecule): Anti codons

D (three at a time): Codons complimentary to anti codons

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Protein Chain

Is the 5′ cap on the right or left hand side of the mRNA molecule above? Left side

This is a diagram of what cellular process? This diagram is portraying the process of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUG CCG 3’, was built from the correct template strand of DNA, 3’TAC GGC 5’. What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ATG CCG 3’, instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site? At the A site the tRNA molecule accepts the amino acid passed from the P site. At the P site of the ribosome the amino accept from the tRNA is passed to the A site.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

The anticodon of the next tRNA molecule would be TTA, it would be carrying the amino acid N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5′-3’______.

7) If the template strand of DNA had the sequence 3′ATG GGC 5′, the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′AUGGGC3′, UAC CCG
  2. 5′AUGGGC3′, AUG GGC
  3. 5′UAC CCG3′, UAC CCG
  4. 5′ UAC CCG3′, AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucine
  2. Glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

The process of multiple ribosomes traveling over one strand of mRNA is necessary because the fact that tRNA filters through the ribosome at random making the process untimely. Multiple ribosomes also allow the multiple proteins to made a the same time greater using the single mRNA copy strand.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

The mutations of a mRNA strand are less dire than a DNA molecule because a DNA molecule makes numerous and all copies for proteins spreading the mutation, rather than the mRNA which is only used a few times then terminated.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figure 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap _C____
  2. Introns_ D____
  3. Exons_ A____
  4. poly-A tail__ B___

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins? Introns are the unnecessary gene material in mRNA, there are removed from mRNA before translation. Exons are the usable and necessary genes which are used to code for proteins. One gene code can code for multiple proteins as different combinations of genes result in different proteins and protein chains.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’TGCAATATT CGATGTCACCGCTCGAGAACGACATCGATTAAC CATATTCG3′ *3’ACGTTATAAGC TAC AGT GGC GAG CTC TTG CTG TAG CTA ATT GGTATAAGC5’


Darwin's God

If you had a four-letter alphabet and all words were three letters, then how many words would there be? The answer is 4 times 4 times 4, or 4-cubed, or 4^3, or 64. That’s how the DNA code works. Our DNA has four molecular “letters” and to create a protein the letters are taken three at a time in words called “codons.” Each codon specifies an amino acid and these 64 different codons are mapped to 20 different amino acids (and a “stop” signal). Since the 64 different codons far exceeds the 20 different amino acids and the stop signal, the code is degenerate. In other words, there are multiple codons that map the same amino acid (just as “absurd” and “ludicrous” have similar meanings).

But why the mismatch? If only 20 different amino acids are coded for, why are there 64 different codons? There is quite a bit of unused messaging power, or what engineers call “bandwidth.” According to evolutionists, it was just another biological kludge revealing nature’s dysteleology.

But ever since its discovery the DNA code has continued to yield hidden treasures of intricacy. For example, the code is cleverly designed at several levels, including minimizing the effects of errors and maximizing information content (such as in supporting overlapping messages).

This makes it even more difficult for evolutionists to explain how the code evolved.

Furthermore the code’s unused bandwidth has been found to be used in a variety of creative ways where additional information is layered on the basic message indicating the amino acid sequence. You can see some examples here, here, here and here.

The new UCSF paper is another such an example of yet another layer of information in the “unused” bandwidth that evolutionists thought was just an inefficient fluke. It has been known for years that a DNA gene, that is used to construct a protein, has some special signals near the beginning that will help the translating process get started correctly.

Now, the new research indicates that similar signals are used throughout the gene. Their purpose is not to help the protein production process get started correctly, but rather to fine-tune the speed of the production process.

It is yet another example of the many different types of information that are layered in a DNA gene which have evolutionists rewriting their script and explaining that “It’s over. None of that happened.”

99 comments:

God must have loved bacteria. He gave them Shine-Dalgarno sequences.

Notes of related interest: It is found that the first DNA code had to be at least as complex as the current DNA code found in life:

Shannon Information - Channel Capacity - Perry Marshall - video
http://www.metacafe.com/watch/5457552/

“Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
Donald E. Johnson – Bioinformatics: The Information in Life

Yet despite this severe constraint on evolability, it is found that DNA is a 'optimal code'

Biophysicist Hubert Yockey determined that natural selection would have to explore 1.40 x 10^70 different genetic codes to discover the optimal universal genetic code that is found in nature. The maximum amount of time available for it to originate is 6.3 x 10^15 seconds. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that is optimal. Put simply, natural selection lacks the time necessary to find the optimal universal genetic code we find in nature. (Fazale Rana, -The Cell's Design - 2008 - page 177)

“The genetic code’s error-minimization properties are far more dramatic than these (one in a million) results indicate. When the researchers calculated the error-minimization capacity of the one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution. Researchers estimate the existence of 10^18 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This means of 10^18 codes few, if any have an error-minimization capacity that approaches the code found universally throughout nature.”
Fazale Rana - From page 175 'The Cell’s Design'
http://www.reasons.org/biology/biochemical-design/fyi-id-dna-deciphering-design-genetic-code

As well there was a ‘optimality’ found for the 20 amino acid set used in the 'standard' Genetic code when the set was compared to 1 million randomly generated alternative amino acid sets

Does Life Use a Non-Random Set of Amino Acids? - Jonathan M. - April 2011
Excerpt: The authors compared the coverage of the standard alphabet of 20 amino acids for size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates. The results? The authors noted that: "…the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof."
http://www.evolutionnews.org/2011/04/does_life_use_a_non-random_set045661.html

Extreme genetic code optimality from a molecular dynamics calculation of amino acid polar requirement – 2009
Excerpt: A molecular dynamics calculation of the amino acid polar requirement is used to score the canonical genetic code. Monte Carlo simulation shows that this computational polar requirement has been optimized by the canonical genetic code, an order of magnitude more than any previously known measure, effectively ruling out a vertical evolution dynamics.
http://pre.aps.org/abstract/PRE/v79/i6/e060901

Collective evolution and the genetic code - 2006:
Excerpt: The genetic code could well be optimized to a greater extent than anything else in biology and yet is generally regarded as the biological element least capable of evolving.
http://www.pnas.org/content/103/28/10696.full

Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes. the present findings support the view that protein-coding regions can carry abundant parallel codes.
http://genome.cshlp.org/content/17/4/405.full

The data compression of some stretches of human DNA is estimated to be up to 12 codes thick (12 different ways of DNA transcription) (Trifonov, 1989). (This is well beyond the complexity of any computer code ever written by man). John Sanford - Genetic Entropy

The multiple codes of nucleotide sequences. Trifonov EN. - 1989
Excerpt: Nucleotide sequences carry genetic information of many different kinds, not just instructions for protein synthesis (triplet code).
http://www.ncbi.nlm.nih.gov/pubmed/2673451

"In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
Donald E. Johnson – Programming of Life – pg.51 - 2010

As well, DNA coding is optimized for energy efficiency

DNA coding is apparently successfully designed along the very stringent guidelines laid out by Landauer's principle of 'reversible computation' in order to achieve such amazing energy efficiency, something man has yet to accomplish in any meaningful way for computers:


Watch the video: PABIO Unit 7 DNA Transcription and Translation (July 2022).


Comments:

  1. Galrajas

    Great! Finally I found a sensible blog on the Internet) Hurray!

  2. Beamard

    We are sorry that they interfere… But they are very close to the theme. They can help with the answer. Write to the PM.

  3. Nikokora

    At me a similar situation. Let's discuss.

  4. Kuruvilla

    Between us speaking, in my opinion, it is obvious. I advise to you to try to look in google.com

  5. Kagasho

    How do you manage to write such interesting texts?

  6. Fenrisida

    In my opinion, they are wrong. Write to me in PM, discuss it.



Write a message